ID: 1032027572

View in Genome Browser
Species Human (GRCh38)
Location 7:128455824-128455846
Sequence AGCCGCGAGCACGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027572_1032027580 -4 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027572_1032027578 -9 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027572_1032027581 -1 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027581 7:128455846-128455868 TATAAGGGGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 236
1032027572_1032027582 19 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027582 7:128455866-128455888 CGGCGTTGCTCTGCGCTCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 77
1032027572_1032027583 26 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027583 7:128455873-128455895 GCTCTGCGCTCTGCGGCTGACGG 0: 1
1: 0
2: 2
3: 13
4: 145
1032027572_1032027579 -5 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027572 Original CRISPR AGCCGCGAGCACGCCCCAGG AGG (reversed) Intergenic