ID: 1032027576

View in Genome Browser
Species Human (GRCh38)
Location 7:128455832-128455854
Sequence GGCGTGCTCGCGGCTATAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 7}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027564_1032027576 23 Left 1032027564 7:128455786-128455808 CCGGGCGTGCGTGCGGCCTCCAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1032027566_1032027576 4 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1032027563_1032027576 24 Left 1032027563 7:128455785-128455807 CCCGGGCGTGCGTGCGGCCTCCA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1032027565_1032027576 7 Left 1032027565 7:128455802-128455824 CCTCCAGTGCGCGTGCGCGTACC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1032027576 7:128455832-128455854 GGCGTGCTCGCGGCTATAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027576 Original CRISPR GGCGTGCTCGCGGCTATAAG GGG Intronic