ID: 1032027578

View in Genome Browser
Species Human (GRCh38)
Location 7:128455838-128455860
Sequence CTCGCGGCTATAAGGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 22}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027564_1032027578 29 Left 1032027564 7:128455786-128455808 CCGGGCGTGCGTGCGGCCTCCAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027566_1032027578 10 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027571_1032027578 -8 Left 1032027571 7:128455823-128455845 CCCTCCTGGGGCGTGCTCGCGGC 0: 1
1: 0
2: 1
3: 11
4: 57
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027572_1032027578 -9 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027565_1032027578 13 Left 1032027565 7:128455802-128455824 CCTCCAGTGCGCGTGCGCGTACC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1032027563_1032027578 30 Left 1032027563 7:128455785-128455807 CCCGGGCGTGCGTGCGGCCTCCA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1032027578 7:128455838-128455860 CTCGCGGCTATAAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027578 Original CRISPR CTCGCGGCTATAAGGGGCGG AGG Intronic