ID: 1032027579

View in Genome Browser
Species Human (GRCh38)
Location 7:128455842-128455864
Sequence CGGCTATAAGGGGCGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027571_1032027579 -4 Left 1032027571 7:128455823-128455845 CCCTCCTGGGGCGTGCTCGCGGC 0: 1
1: 0
2: 1
3: 11
4: 57
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027573_1032027579 -8 Left 1032027573 7:128455827-128455849 CCTGGGGCGTGCTCGCGGCTATA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027572_1032027579 -5 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027565_1032027579 17 Left 1032027565 7:128455802-128455824 CCTCCAGTGCGCGTGCGCGTACC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96
1032027566_1032027579 14 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027579 7:128455842-128455864 CGGCTATAAGGGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027579 Original CRISPR CGGCTATAAGGGGCGGAGGC TGG Intronic