ID: 1032027580

View in Genome Browser
Species Human (GRCh38)
Location 7:128455843-128455865
Sequence GGCTATAAGGGGCGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027571_1032027580 -3 Left 1032027571 7:128455823-128455845 CCCTCCTGGGGCGTGCTCGCGGC 0: 1
1: 0
2: 1
3: 11
4: 57
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027565_1032027580 18 Left 1032027565 7:128455802-128455824 CCTCCAGTGCGCGTGCGCGTACC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027572_1032027580 -4 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027573_1032027580 -7 Left 1032027573 7:128455827-128455849 CCTGGGGCGTGCTCGCGGCTATA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131
1032027566_1032027580 15 Left 1032027566 7:128455805-128455827 CCAGTGCGCGTGCGCGTACCCTC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1032027580 7:128455843-128455865 GGCTATAAGGGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027580 Original CRISPR GGCTATAAGGGGCGGAGGCT GGG Intronic