ID: 1032027583

View in Genome Browser
Species Human (GRCh38)
Location 7:128455873-128455895
Sequence GCTCTGCGCTCTGCGGCTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032027571_1032027583 27 Left 1032027571 7:128455823-128455845 CCCTCCTGGGGCGTGCTCGCGGC 0: 1
1: 0
2: 1
3: 11
4: 57
Right 1032027583 7:128455873-128455895 GCTCTGCGCTCTGCGGCTGACGG 0: 1
1: 0
2: 2
3: 13
4: 145
1032027572_1032027583 26 Left 1032027572 7:128455824-128455846 CCTCCTGGGGCGTGCTCGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1032027583 7:128455873-128455895 GCTCTGCGCTCTGCGGCTGACGG 0: 1
1: 0
2: 2
3: 13
4: 145
1032027573_1032027583 23 Left 1032027573 7:128455827-128455849 CCTGGGGCGTGCTCGCGGCTATA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1032027583 7:128455873-128455895 GCTCTGCGCTCTGCGGCTGACGG 0: 1
1: 0
2: 2
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032027583 Original CRISPR GCTCTGCGCTCTGCGGCTGA CGG Exonic