ID: 1032028002

View in Genome Browser
Species Human (GRCh38)
Location 7:128458596-128458618
Sequence TCACATAACTGGTTGATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032028002_1032028005 0 Left 1032028002 7:128458596-128458618 CCATGTATCAACCAGTTATGTGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1032028005 7:128458619-128458641 GCCTAGGCCACGATTATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032028002 Original CRISPR TCACATAACTGGTTGATACA TGG (reversed) Intergenic