ID: 1032031831

View in Genome Browser
Species Human (GRCh38)
Location 7:128490808-128490830
Sequence TATGTGAGTTTGTTTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032031831_1032031835 1 Left 1032031831 7:128490808-128490830 CCAATGAGAAACAAACTCACATA No data
Right 1032031835 7:128490832-128490854 TTGGAGAAGATGGACATTGAGGG No data
1032031831_1032031833 -9 Left 1032031831 7:128490808-128490830 CCAATGAGAAACAAACTCACATA No data
Right 1032031833 7:128490822-128490844 ACTCACATATTTGGAGAAGATGG 0: 1
1: 1
2: 2
3: 23
4: 246
1032031831_1032031836 29 Left 1032031831 7:128490808-128490830 CCAATGAGAAACAAACTCACATA No data
Right 1032031836 7:128490860-128490882 GCCTTAAAATGTATCTGTTATGG No data
1032031831_1032031834 0 Left 1032031831 7:128490808-128490830 CCAATGAGAAACAAACTCACATA No data
Right 1032031834 7:128490831-128490853 TTTGGAGAAGATGGACATTGAGG 0: 1
1: 0
2: 4
3: 34
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032031831 Original CRISPR TATGTGAGTTTGTTTCTCAT TGG (reversed) Intronic