ID: 1032031836

View in Genome Browser
Species Human (GRCh38)
Location 7:128490860-128490882
Sequence GCCTTAAAATGTATCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032031831_1032031836 29 Left 1032031831 7:128490808-128490830 CCAATGAGAAACAAACTCACATA No data
Right 1032031836 7:128490860-128490882 GCCTTAAAATGTATCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032031836 Original CRISPR GCCTTAAAATGTATCTGTTA TGG Intronic