ID: 1032035791

View in Genome Browser
Species Human (GRCh38)
Location 7:128520332-128520354
Sequence ACGTCAGACGGGCAACTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032035777_1032035791 26 Left 1032035777 7:128520283-128520305 CCCAGAGTGAGGGCCTGGAGGGT No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data
1032035786_1032035791 -6 Left 1032035786 7:128520315-128520337 CCAGTGTGGGCGGCCACACGTCA No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data
1032035778_1032035791 25 Left 1032035778 7:128520284-128520306 CCAGAGTGAGGGCCTGGAGGGTG No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data
1032035780_1032035791 13 Left 1032035780 7:128520296-128520318 CCTGGAGGGTGGCCTTTGCCCAG No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data
1032035785_1032035791 -5 Left 1032035785 7:128520314-128520336 CCCAGTGTGGGCGGCCACACGTC No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data
1032035784_1032035791 1 Left 1032035784 7:128520308-128520330 CCTTTGCCCAGTGTGGGCGGCCA No data
Right 1032035791 7:128520332-128520354 ACGTCAGACGGGCAACTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032035791 Original CRISPR ACGTCAGACGGGCAACTTGG TGG Intergenic
No off target data available for this crispr