ID: 1032037367

View in Genome Browser
Species Human (GRCh38)
Location 7:128530879-128530901
Sequence GGGGGCCGCCGAGGCGGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032037356_1032037367 8 Left 1032037356 7:128530848-128530870 CCGAGGGGTTGGGCAGGGGTTGG 0: 1
1: 1
2: 3
3: 54
4: 466
Right 1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG 0: 1
1: 1
2: 1
3: 15
4: 165
1032037348_1032037367 23 Left 1032037348 7:128530833-128530855 CCCAAACTCGCGGAGCCGAGGGG No data
Right 1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG 0: 1
1: 1
2: 1
3: 15
4: 165
1032037350_1032037367 22 Left 1032037350 7:128530834-128530856 CCAAACTCGCGGAGCCGAGGGGT 0: 1
1: 1
2: 0
3: 0
4: 19
Right 1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG 0: 1
1: 1
2: 1
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032037367 Original CRISPR GGGGGCCGCCGAGGCGGATC CGG Intergenic
900135813 1:1116486-1116508 GGGGGCGGCCGGGGCGGCTTCGG + Intergenic
900180199 1:1307897-1307919 GGCGGGCGCCGAGGCGGCGCGGG - Exonic
900310786 1:2032295-2032317 GGGAGCAGCAGAGCCGGATCTGG + Intergenic
900390903 1:2433379-2433401 GGGGGCTGCTGAGGCCCATCCGG + Intronic
901045469 1:6393307-6393329 GGGGGCTGCGGCGGCGGATGCGG + Intronic
902876329 1:19342977-19342999 GGGGGATGCCGTGGCGGCTCTGG + Intronic
904306712 1:29594673-29594695 GGGGGCCTCTGAGGGGGACCAGG + Intergenic
907296532 1:53459627-53459649 GCAGGCCGCCGAGGAGGAGCAGG + Exonic
912381318 1:109249656-109249678 GGGGGCCGCCGGGGCCGGGCCGG + Intergenic
915109356 1:153553249-153553271 GGGGGCGGGGGAGGCGGCTCTGG - Intergenic
915389040 1:155524282-155524304 GGAGGCTGACGGGGCGGATCAGG + Intronic
915637094 1:157194949-157194971 GAGGGACCCCGAGGCGGAGCTGG + Intergenic
916233346 1:162561658-162561680 GGGGGCCGCGGCGGCGGGGCGGG - Exonic
918045927 1:180941071-180941093 AGGGGCAGCCGAGGGGGAGCCGG - Exonic
921060218 1:211578875-211578897 GGGGGCTGCTGAGGCTGAGCCGG - Intergenic
921708040 1:218346195-218346217 GGGGGCCGCCGAGGCTGACCTGG - Intergenic
923191752 1:231626825-231626847 GGAGGCAGCCCAGGCGGAGCGGG + Exonic
924947884 1:248858207-248858229 TGTGGCCGCCCAGGCGGATGCGG + Exonic
1063504152 10:6580568-6580590 GGAGGGCGGCGAGGCGGAGCAGG + Intergenic
1072283787 10:93894126-93894148 GGCGGCCGCCGAGGCAGCTGGGG + Exonic
1073099601 10:100999787-100999809 GGGCGCCGCGGAGGCGGAGGCGG + Exonic
1074065358 10:110008207-110008229 GGCGGCCGCAGCGGCGGATCCGG + Exonic
1074571898 10:114632072-114632094 GGGGCCCGCCGAGGCGGGGCGGG - Intronic
1075769102 10:124917769-124917791 GGGGGACGACGAGGCGGGTGGGG + Intergenic
1077196599 11:1284085-1284107 GGGGGCAGCCAGGGCGCATCAGG + Intronic
1077635864 11:3840990-3841012 GCGGGCCGGCGAGGCGGGGCGGG + Intergenic
1083728846 11:64642647-64642669 GGGGGCGGCCGAGGGGGCCCGGG - Intronic
1084372169 11:68751330-68751352 GGGGGCTGCCGGGCCGGGTCGGG - Intronic
1089584579 11:119502327-119502349 GGGGGCTGCCCAGGGGGCTCAGG + Intergenic
1091550184 12:1530675-1530697 GGGTCCCGCCGAGGCGTCTCGGG - Intronic
1092256431 12:6928573-6928595 GGGGCCCGCCGAGGAGAGTCGGG + Intronic
1096654445 12:53079620-53079642 GGGCGCCGCTGAGGCGGACAGGG + Intergenic
1096716211 12:53493051-53493073 GGGGGCCGCGGCGGCGGAAGGGG + Intronic
1096843210 12:54391340-54391362 GAGGCCGGCCGAGGCGGAGCGGG + Intergenic
1097267760 12:57755622-57755644 GGGGGCCGGGGAGGCGGCTGCGG + Exonic
1100175380 12:92024157-92024179 GGGGGCCCCCAAGGCTGATATGG - Intronic
1102991397 12:117318786-117318808 GGAGGCCGCCGAGGAGCAGCTGG + Intronic
1102997016 12:117359196-117359218 GGGGCCCGCCGTGGCGGTGCTGG + Intronic
1103209278 12:119154684-119154706 TGGGGCCGGGGAGGCGGAGCTGG + Intronic
1103386308 12:120534921-120534943 TGGCCCCGCCGAGGCGGAGCGGG - Exonic
1104862216 12:131929641-131929663 GGGGTCGGCAGAGGCGGAGCTGG + Exonic
1105249113 13:18680602-18680624 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1105498793 13:20953404-20953426 GAGGGACACCGAGGCGGAGCCGG - Intergenic
1105675299 13:22664716-22664738 GGAGGCCGAGGGGGCGGATCAGG - Intergenic
1110597025 13:77329926-77329948 GGGGGCCGCCTGGGCGGCTTGGG + Intergenic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113902211 13:113803687-113803709 GGGGGCAGCCGAGGTGGGCCTGG - Intronic
1119562889 14:75605052-75605074 GGGGGGCGCCCAGGCTTATCAGG + Intronic
1122436703 14:101705964-101705986 GCGGGCCGCAGAGGAGGCTCGGG - Intergenic
1123040980 14:105490165-105490187 GGGGGGCCCCGAGGCGGGGCCGG + Intronic
1123630625 15:22257849-22257871 GGGGGCCGCGGCCGCGGAACGGG - Intergenic
1124109564 15:26773268-26773290 GGCGGCCGCCGAGGCGGGAGGGG - Intronic
1124696832 15:31870614-31870636 GGGGGCCGCGGAGCCCGAGCGGG - Intronic
1125698516 15:41660034-41660056 GGGCGCGGCCGGGGCGGAGCCGG + Intronic
1129298936 15:74614751-74614773 GGCGGCCGCCGGGGCGGTGCTGG + Intronic
1129709434 15:77813004-77813026 GGGGGCCAACTAGGCTGATCCGG - Intronic
1131174511 15:90201468-90201490 GGGGGCCCCCGGGGCGACTCGGG + Exonic
1131257379 15:90871552-90871574 GGCGACCGCCGCGGCGGCTCGGG - Intronic
1141608759 16:85169900-85169922 GGCGGCCGCCGTGGCGGCGCCGG + Intergenic
1142163331 16:88570620-88570642 GGAGGCCGCCGAGGCGGCGGCGG + Intronic
1143150855 17:4807115-4807137 GGGGCCGGCCGAGGCGGGGCCGG - Exonic
1144710426 17:17398236-17398258 GGGGGAAGCCGAGGTGAATCTGG - Intergenic
1146322712 17:31859145-31859167 GGGGGCCGCGGAGCCGTCTCGGG - Exonic
1147705364 17:42422026-42422048 GTGGGCCGCCGAGGCCGATGTGG + Intronic
1148183968 17:45627887-45627909 GGGGGCCGGAGAGGGGGATCAGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148808213 17:50274729-50274751 GGGGGCAGCGGAGGAGGCTCTGG + Intronic
1149865741 17:60150114-60150136 GGGGACCGCCGAGGGGCACCTGG - Intronic
1149995732 17:61405141-61405163 GGAGGCCGACGAGCAGGATCAGG - Intronic
1150108323 17:62478345-62478367 GGGGGCCGGCGAGGCGGATCCGG + Intronic
1150423172 17:65056604-65056626 GGGGCCCGCCGAGGCGGCGGCGG - Exonic
1150631798 17:66885233-66885255 GGGGGCGGCCGAGGCTCAGCAGG - Exonic
1151580105 17:74972719-74972741 GGGGGCCGCGGAGCTGGAGCCGG - Exonic
1152381521 17:79944809-79944831 GGGGGGCGGCGAGGCGGACAGGG + Intronic
1152639296 17:81442999-81443021 GATGGCCGCCGAGGTGGAGCAGG + Exonic
1152934151 17:83126263-83126285 GGGGGCAGCAGAGGCAGCTCTGG + Intergenic
1154439772 18:14378628-14378650 GGGGGCCCCCGAGGAGGAGGAGG - Intergenic
1155075219 18:22348640-22348662 CGGGGCCGCCCAGCCGGAGCCGG - Intergenic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1157548070 18:48561553-48561575 GGGGGCTGCAGAGATGGATCAGG + Intronic
1159057071 18:63476865-63476887 GAGTGCCGCCGAGGCGGGGCGGG + Exonic
1160813828 19:1026462-1026484 GGGGGCGACCGAGGGGGCTCAGG + Intergenic
1160886844 19:1354137-1354159 GGGGGCTGGCGAGGTGGCTCAGG + Intergenic
1161065850 19:2236924-2236946 GGCGGCGGCCGACGCGGACCGGG + Exonic
1161215770 19:3094493-3094515 GGCGGCGGCCGAGGCGGGGCGGG + Exonic
1161215799 19:3094563-3094585 GGCGGCGGCCGAGGCGGCTCCGG + Exonic
1161350081 19:3786421-3786443 GGGGGCCGCGGAGGCGGGGCGGG - Intronic
1161457438 19:4376617-4376639 GGGGGCCGCCCAGGCAGATGGGG - Intronic
1161666417 19:5579733-5579755 TGGGGCCGCAGTGGCTGATCAGG - Intergenic
1162531663 19:11239684-11239706 GGGGGCCGCTGAGGCAGGCCGGG - Exonic
1162901003 19:13795569-13795591 GGGAGCCGGCGAAGCGGAGCGGG + Exonic
1163282314 19:16325324-16325346 GGGGGCGGCGGCGGCGGCTCCGG - Exonic
1166354126 19:42217158-42217180 GGGGGAGGCCGAGGCGGTTGGGG - Intronic
1167269250 19:48498617-48498639 GGGGGCGGCCGAGGAGGAAGGGG - Exonic
1168339171 19:55613982-55614004 GCGGGCGGCAGGGGCGGATCGGG - Exonic
1168339697 19:55615889-55615911 GGGGGCGGCCGTGGCGGCACTGG + Exonic
1202683113 1_KI270712v1_random:28798-28820 GGGGGGAGCCGCGGCGGATGGGG - Intergenic
929075235 2:38075112-38075134 GGCAGCTGCCCAGGCGGATCTGG + Exonic
929857873 2:45651331-45651353 GGCGGCCGCCGATCCGGCTCGGG - Intronic
934552128 2:95269021-95269043 GAGGGCAGCCGAGGAGGCTCTGG + Intergenic
937706916 2:124931683-124931705 GGAGGCCGAGGAGGGGGATCAGG + Intergenic
940639128 2:156329595-156329617 GGGGCCCGTCGAAGCGCATCTGG + Exonic
941906165 2:170717056-170717078 CGGCGCCCCCGAGGCGGAGCCGG + Exonic
947506591 2:230712779-230712801 GGGGGCGCCCGAGGCGGAAGGGG + Intergenic
948401902 2:237691420-237691442 GCGGGCCGCTGGGGCCGATCTGG - Intronic
1173001664 20:39109785-39109807 GGGGGCTGCCGGGGTGGAACCGG - Intergenic
1173687380 20:44933092-44933114 GGGGGGCGCCGAGGCACAACTGG - Exonic
1173736199 20:45363349-45363371 GGGGGCCGCGCAGGCGGAATGGG + Intronic
1175636204 20:60586530-60586552 GGGGGCAGTGAAGGCGGATCAGG - Intergenic
1176308196 21:5135362-5135384 TGGGGCCGCGGAGGCTGTTCCGG + Intronic
1176455972 21:6911145-6911167 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1176834146 21:13776193-13776215 GGGGGCCCCCGAGGAGGAGGAGG + Intergenic
1178673884 21:34614879-34614901 GGGGGCGGCCGAGGCGGACGAGG - Exonic
1179848864 21:44126670-44126692 TGGGGCCGCGGAGGCTGTTCCGG - Intronic
1180198156 21:46209506-46209528 GGGGGCTGAAGAGGGGGATCAGG - Intronic
1180699888 22:17775527-17775549 TGGGGCTGCCGAGGAGGAACAGG - Intergenic
1183935136 22:41257699-41257721 GGGGGCTGCAGAGGCGGCTCAGG + Intronic
1184561942 22:45268618-45268640 GGGGGCGGGCGAGGGGGATGGGG - Intergenic
950316325 3:12004682-12004704 GGGCGCCGCCGAGGCCGAGGCGG - Exonic
954912700 3:54122401-54122423 CGGGGCCGCCGAGGCGGGGCCGG + Intergenic
956805211 3:72803132-72803154 GGGGGCCTCCCAGGCTGACCTGG + Intronic
966868557 3:184276012-184276034 GGGGGCGGCCGCGGCCGAGCGGG + Intronic
967889221 3:194353273-194353295 GGGGGCCGCTGAGGGGGAGCTGG - Intergenic
968286733 3:197513252-197513274 CCGGGAAGCCGAGGCGGATCTGG + Intronic
968693572 4:2009053-2009075 GCGGGCCGCAGAGGCGGCGCAGG + Exonic
969256867 4:6008244-6008266 GGGCGCCACCGAGGCGGCTGCGG - Intergenic
969330543 4:6471653-6471675 GCGGGCCTCCCAGGAGGATCTGG + Intronic
971757452 4:30721366-30721388 GGGGGGCGCCGAGGGGGCTGTGG + Exonic
980941640 4:139280272-139280294 GGGGGCCGCGGAGGCGGGGCTGG - Exonic
983752880 4:171298555-171298577 GGAGCCCGCAGAGGCGGAGCGGG - Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
986695785 5:10353653-10353675 GCGGGGCGCCGAGGCGGAAGGGG - Intergenic
986721472 5:10563962-10563984 GGGGGACGCCGGGGCGGAGCCGG - Intergenic
988949546 5:36242473-36242495 GGGGGCTGAGGAGGCGGACCCGG + Intergenic
992796083 5:80256106-80256128 GGGGGCGGGCGAGGCGGGGCCGG - Intergenic
997994897 5:138577594-138577616 GGGGGGCGCTGAGGCGGCACTGG - Intergenic
1000319065 5:160119313-160119335 GGGCGCCGGCGAGGCCGAGCCGG - Exonic
1002058075 5:176610067-176610089 GGAGGCAGCCGAGGCCGCTCGGG - Exonic
1003278128 6:4669728-4669750 GGAGGCCGAGGCGGCGGATCAGG - Intergenic
1004134944 6:12957379-12957401 GGGGACGGCCGAGGCAGGTCGGG + Intronic
1007363233 6:41373249-41373271 GGGAGCCGGCGCGGCGGCTCGGG - Intergenic
1007607176 6:43125412-43125434 GGGGGTGGCCGAGGCTGAGCTGG + Intronic
1011607459 6:89118363-89118385 GAGGGCCGCGGAGGCTGAGCGGG - Intergenic
1013619325 6:111873024-111873046 CGGCGCGGCCGAGGCGGCTCCGG + Exonic
1018942712 6:168319834-168319856 GGGGGTCGGCGGGGCGGGTCCGG - Intergenic
1019479652 7:1260583-1260605 GGTGGGCGCCGAGGCCGGTCTGG - Intergenic
1020081409 7:5287918-5287940 GGAGGCGGCGGAGGCGGCTCAGG + Exonic
1020098713 7:5382531-5382553 GGGGTCCGGGGAAGCGGATCGGG + Intronic
1025197504 7:56944230-56944252 GGAGGCGGCGGAGGCGGCTCAGG - Intergenic
1025674443 7:63632709-63632731 GGAGGCGGCGGAGGCGGCTCAGG + Intergenic
1026867464 7:73832397-73832419 GGGGGCCAGAGAGGCGGCTCAGG + Exonic
1027233096 7:76283138-76283160 TGGGGCCGCTGACCCGGATCAGG + Intronic
1027654981 7:80919233-80919255 GGGAGCCGCGGGGGCGGACCGGG + Exonic
1029439274 7:100578260-100578282 TGGGGCCAGCCAGGCGGATCTGG + Intronic
1032037367 7:128530879-128530901 GGGGGCCGCCGAGGCGGATCCGG + Intergenic
1032062851 7:128739304-128739326 GGCCGCCGGCGAGGCGGATGAGG + Exonic
1032125331 7:129189051-129189073 GGCGGCCGCGGAGGCGGCTCAGG - Exonic
1033654024 7:143361787-143361809 GGGGGCCGGCGGGGCGGGGCCGG - Intronic
1042829269 8:73009039-73009061 GGGGGCCCCCGAGGAGGAGGAGG + Exonic
1044719863 8:95134320-95134342 GGGGGCCGCCGGGTAGGGTCCGG + Intronic
1050472621 9:6008219-6008241 GGGGGCCGCAGCGGCGGCTCCGG + Intergenic
1051891541 9:21947138-21947160 TGGGGAGGCCGAGGCGGGTCAGG - Intronic
1051897966 9:22008729-22008751 GGGCGCGGCCTCGGCGGATCGGG - Intronic
1053138275 9:35665239-35665261 GGGAGCCGCGGAGGCGGGGCCGG + Exonic
1054787285 9:69221443-69221465 GGGGGCGGCCGGGGCCCATCGGG + Exonic
1056078236 9:83062878-83062900 GGGGGCGGCCGAGAGGGCTCCGG + Exonic
1057146817 9:92764372-92764394 GTGGGCCGCCGGGGCGGAGGGGG - Intronic
1061148980 9:128818384-128818406 GGGGGCCTGCGAGGCGGGTGCGG + Intergenic
1061859366 9:133460251-133460273 TGGGGCCGCCGGGGCGGGGCGGG - Intronic
1062250036 9:135589264-135589286 TGGGGCCTCCAAGGCGGAACAGG - Intergenic
1062613131 9:137383843-137383865 GGGGGCCTCCCAGGCGGGGCTGG - Intronic
1062627082 9:137448219-137448241 GGCGGCCGCGGTGGAGGATCAGG + Exonic
1185451161 X:281138-281160 GGGGGCCGTGCAGGCGGAGCGGG + Intronic
1185508282 X:644518-644540 GGCGGCGGCCGAGGCGGACTCGG - Exonic
1185832550 X:3316075-3316097 GGGGCCGGGCGCGGCGGATCAGG + Intronic
1187173128 X:16870537-16870559 GCCGGCCGCGGAGGCGGATGGGG + Intergenic
1192260998 X:69505766-69505788 GGGGGCCGCAGAGGGGGGGCCGG - Exonic
1192657131 X:73003492-73003514 GGGGGAGGCGGAGGCGGATGCGG + Intergenic
1192664989 X:73079509-73079531 GGGGGAGGCGGAGGCGGATGCGG - Exonic
1195654740 X:107323890-107323912 GAGGGGCCCCGAGGCGGAGCTGG + Intergenic
1200002599 X:153069707-153069729 GGGGGCGGCCGAGGCGGGGGGGG + Intergenic
1200005125 X:153080303-153080325 GGGGGCGGCCGAGGCGGGGGGGG - Intergenic