ID: 1032049679

View in Genome Browser
Species Human (GRCh38)
Location 7:128640094-128640116
Sequence GCTACTTGGGAGTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345578
Summary {0: 31, 1: 494, 2: 16352, 3: 113220, 4: 215481}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049679_1032049694 30 Left 1032049679 7:128640094-128640116 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049679_1032049689 11 Left 1032049679 7:128640094-128640116 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049679 Original CRISPR GCTACTTGGGAGTCTGGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr