ID: 1032049680

View in Genome Browser
Species Human (GRCh38)
Location 7:128640095-128640117
Sequence AGCTACTTGGGAGTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92442
Summary {0: 33, 1: 496, 2: 14727, 3: 30337, 4: 46849}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049680_1032049694 29 Left 1032049680 7:128640095-128640117 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049680_1032049689 10 Left 1032049680 7:128640095-128640117 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049680 Original CRISPR AGCTACTTGGGAGTCTGGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr