ID: 1032049682

View in Genome Browser
Species Human (GRCh38)
Location 7:128640098-128640120
Sequence TCCAGCTACTTGGGAGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590101
Summary {0: 85, 1: 6786, 2: 109153, 3: 219239, 4: 254838}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049682_1032049694 26 Left 1032049682 7:128640098-128640120 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049682_1032049689 7 Left 1032049682 7:128640098-128640120 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049682 Original CRISPR TCCAGCTACTTGGGAGTCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr