ID: 1032049683

View in Genome Browser
Species Human (GRCh38)
Location 7:128640099-128640121
Sequence TTCCAGCTACTTGGGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049683_1032049694 25 Left 1032049683 7:128640099-128640121 CCCAGACTCCCAAGTAGCTGGAA No data
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049683_1032049689 6 Left 1032049683 7:128640099-128640121 CCCAGACTCCCAAGTAGCTGGAA No data
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049683 Original CRISPR TTCCAGCTACTTGGGAGTCT GGG (reversed) Intergenic
No off target data available for this crispr