ID: 1032049684

View in Genome Browser
Species Human (GRCh38)
Location 7:128640100-128640122
Sequence GTTCCAGCTACTTGGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049684_1032049694 24 Left 1032049684 7:128640100-128640122 CCAGACTCCCAAGTAGCTGGAAC No data
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049684_1032049689 5 Left 1032049684 7:128640100-128640122 CCAGACTCCCAAGTAGCTGGAAC No data
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049684 Original CRISPR GTTCCAGCTACTTGGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr