ID: 1032049687

View in Genome Browser
Species Human (GRCh38)
Location 7:128640107-128640129
Sequence ACCCGTAGTTCCAGCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383859
Summary {0: 25, 1: 987, 2: 20064, 3: 110438, 4: 252345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049687_1032049694 17 Left 1032049687 7:128640107-128640129 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049687_1032049689 -2 Left 1032049687 7:128640107-128640129 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049687 Original CRISPR ACCCGTAGTTCCAGCTACTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr