ID: 1032049688

View in Genome Browser
Species Human (GRCh38)
Location 7:128640108-128640130
Sequence CACCCGTAGTTCCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279565
Summary {0: 29, 1: 1597, 2: 33463, 3: 109179, 4: 135297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049688_1032049689 -3 Left 1032049688 7:128640108-128640130 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049688_1032049694 16 Left 1032049688 7:128640108-128640130 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049688 Original CRISPR CACCCGTAGTTCCAGCTACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr