ID: 1032049689

View in Genome Browser
Species Human (GRCh38)
Location 7:128640128-128640150
Sequence GTGTGCACCACCACCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049678_1032049689 29 Left 1032049678 7:128640076-128640098 CCAGGCTCAAGGGATTCTCCCAC 0: 44
1: 1029
2: 8750
3: 26625
4: 115695
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049684_1032049689 5 Left 1032049684 7:128640100-128640122 CCAGACTCCCAAGTAGCTGGAAC No data
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049683_1032049689 6 Left 1032049683 7:128640099-128640121 CCCAGACTCCCAAGTAGCTGGAA No data
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049680_1032049689 10 Left 1032049680 7:128640095-128640117 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049688_1032049689 -3 Left 1032049688 7:128640108-128640130 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049679_1032049689 11 Left 1032049679 7:128640094-128640116 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049682_1032049689 7 Left 1032049682 7:128640098-128640120 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049677_1032049689 30 Left 1032049677 7:128640075-128640097 CCCAGGCTCAAGGGATTCTCCCA 0: 38
1: 1122
2: 10722
3: 42336
4: 129426
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data
1032049687_1032049689 -2 Left 1032049687 7:128640107-128640129 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 1032049689 7:128640128-128640150 GTGTGCACCACCACCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049689 Original CRISPR GTGTGCACCACCACCACACC TGG Intergenic
No off target data available for this crispr