ID: 1032049694

View in Genome Browser
Species Human (GRCh38)
Location 7:128640147-128640169
Sequence CTGGCTAATGTTTCTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032049687_1032049694 17 Left 1032049687 7:128640107-128640129 CCCAAGTAGCTGGAACTACGGGT 0: 25
1: 987
2: 20064
3: 110438
4: 252345
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049680_1032049694 29 Left 1032049680 7:128640095-128640117 CCACCCCAGACTCCCAAGTAGCT 0: 33
1: 496
2: 14727
3: 30337
4: 46849
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049682_1032049694 26 Left 1032049682 7:128640098-128640120 CCCCAGACTCCCAAGTAGCTGGA 0: 85
1: 6786
2: 109153
3: 219239
4: 254838
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049683_1032049694 25 Left 1032049683 7:128640099-128640121 CCCAGACTCCCAAGTAGCTGGAA No data
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049679_1032049694 30 Left 1032049679 7:128640094-128640116 CCCACCCCAGACTCCCAAGTAGC 0: 31
1: 494
2: 16352
3: 113220
4: 215481
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049688_1032049694 16 Left 1032049688 7:128640108-128640130 CCAAGTAGCTGGAACTACGGGTG 0: 29
1: 1597
2: 33463
3: 109179
4: 135297
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data
1032049684_1032049694 24 Left 1032049684 7:128640100-128640122 CCAGACTCCCAAGTAGCTGGAAC No data
Right 1032049694 7:128640147-128640169 CTGGCTAATGTTTCTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032049694 Original CRISPR CTGGCTAATGTTTCTTTTTT TGG Intergenic
No off target data available for this crispr