ID: 1032051746

View in Genome Browser
Species Human (GRCh38)
Location 7:128654313-128654335
Sequence GGCCACCGGGAGGCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 36, 2: 19, 3: 96, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032051746_1032051758 27 Left 1032051746 7:128654313-128654335 CCAGCTTGGGCCTCCCGGTGGCC 0: 1
1: 36
2: 19
3: 96
4: 480
Right 1032051758 7:128654363-128654385 GGCCTCTCCAGGCCCAGCTCCGG No data
1032051746_1032051755 16 Left 1032051746 7:128654313-128654335 CCAGCTTGGGCCTCCCGGTGGCC 0: 1
1: 36
2: 19
3: 96
4: 480
Right 1032051755 7:128654352-128654374 GTCCCGAAGTCGGCCTCTCCAGG No data
1032051746_1032051752 6 Left 1032051746 7:128654313-128654335 CCAGCTTGGGCCTCCCGGTGGCC 0: 1
1: 36
2: 19
3: 96
4: 480
Right 1032051752 7:128654342-128654364 GGCCCAAATCGTCCCGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032051746 Original CRISPR GGCCACCGGGAGGCCCAAGC TGG (reversed) Intergenic
900013695 1:135556-135578 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900013723 1:135656-135678 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900014269 1:137758-137780 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900014395 1:138260-138282 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900014558 1:139067-139089 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900043765 1:491539-491561 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900043793 1:491639-491661 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900044132 1:492960-492982 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900044260 1:493462-493484 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900044424 1:494269-494291 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900065202 1:726542-726564 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900065230 1:726642-726664 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900065541 1:727866-727888 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900065668 1:728368-728390 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900065830 1:729175-729197 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900513794 1:3072019-3072041 GGCCACTGGGGCACCCAAGCCGG + Intronic
900658991 1:3773511-3773533 TCCCACCGGGAGGCCCATGGTGG + Intronic
900695629 1:4008104-4008126 GGCCACCCACATGCCCAAGCTGG + Intergenic
901776065 1:11561150-11561172 GGCCACGGGAGGGCCCCAGCTGG + Intergenic
901913690 1:12481189-12481211 AGGCACGGGGAGGCCCAGGCAGG + Intronic
902148797 1:14425729-14425751 GGCCACTGGGAGGACCAAGTGGG - Intergenic
902544946 1:17184339-17184361 AGCCACCAGGATCCCCAAGCAGG - Intergenic
903007946 1:20310750-20310772 GGTCCCGGGGAGGCCCCAGCAGG - Intronic
903174867 1:21574860-21574882 GGCCACCGCGAGGCTCAGACTGG + Intronic
903888916 1:26556930-26556952 GCCCACCAGGAGCCCCATGCAGG - Intronic
905152787 1:35945048-35945070 GGACTCTGGGAGGCCAAAGCAGG - Intronic
905812393 1:40922272-40922294 GCACTCTGGGAGGCCCAAGCAGG - Intergenic
905910130 1:41647874-41647896 GGCCTCCCAGAGGCCCAAGGAGG - Intronic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
906962107 1:50425148-50425170 GCCCACCGGGAGGCTGAGGCTGG + Intergenic
910500273 1:87882511-87882533 GGCCACAGTGGGGCCCTAGCTGG - Intergenic
910551255 1:88477950-88477972 GACCACCGGGTTGCCCAAGGAGG - Intergenic
911094247 1:94042893-94042915 TGCCACCTGGAGGCACAAGAAGG + Exonic
912486734 1:110034895-110034917 GCCCTCCGGGAAGCCCAACCTGG - Intronic
915165509 1:153946038-153946060 GGCCGCCGCGTGACCCAAGCGGG + Intronic
915177291 1:154026592-154026614 GGCCTCTGGGAGGCCAATGCAGG - Intronic
915590526 1:156867917-156867939 GGCCATTGGGAGGCCGAGGCGGG - Intronic
917969279 1:180196843-180196865 GGCCAGCTGGAGGCCCGAGCTGG + Exonic
918102874 1:181391654-181391676 GACCACTGGGAGGCCCCAGGGGG - Intergenic
918455719 1:184711344-184711366 GGACACTGGGAGGCCAAGGCAGG - Intronic
922100093 1:222472488-222472510 GGCTGCCAGGAGGCCCAAGCTGG + Intergenic
922100117 1:222472587-222472609 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
922100326 1:222473415-222473437 GGCCACCGTGAGGCCTGACCTGG + Intergenic
922100474 1:222474020-222474042 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
922100518 1:222474208-222474230 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
922100764 1:222475505-222475527 GGCTGCCGGGAGGCCAAAGGTGG + Intergenic
922262068 1:223951755-223951777 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
922262111 1:223951955-223951977 GGCCGACGGGAGGCACAGGCTGG + Intergenic
922733662 1:227968148-227968170 GGCCACCGTGAGGCATGAGCTGG - Intergenic
922734110 1:227970468-227970490 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
922734155 1:227970657-227970679 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
922734200 1:227970823-227970845 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
922734325 1:227971324-227971346 GGCCACCGTGAGGCCTGACCTGG - Intergenic
922734613 1:227972456-227972478 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
922734899 1:227973598-227973620 GGCCACCGTGAGGCCTGACCTGG - Intergenic
922734927 1:227973697-227973719 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
922734945 1:227973760-227973782 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
922735049 1:227974190-227974212 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
923800751 1:237206028-237206050 GGCCACCGGGTCCACCAAGCGGG + Intronic
924343291 1:243054153-243054175 GGCCGCCAGGAGGCCCAAGCTGG + Intergenic
924343319 1:243054252-243054274 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
924343531 1:243055070-243055092 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
924343592 1:243055348-243055370 GGCCACCGTGAGGCCTGACCTGG + Intergenic
924343713 1:243055834-243055856 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
924343880 1:243056641-243056663 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1064189714 10:13195155-13195177 GGCCACAATGACGCCCAAGCTGG + Exonic
1066732451 10:38448422-38448444 GGCCACCGTGAGGCATGAGCTGG - Intergenic
1066732529 10:38448771-38448793 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1066733157 10:38451277-38451299 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1066733185 10:38451376-38451398 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1066733203 10:38451439-38451461 GGCCGCCAGGAGGCCGGAGCTGG - Intergenic
1068372672 10:56138202-56138224 GGACTTTGGGAGGCCCAAGCGGG - Intergenic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1069917667 10:71797380-71797402 AGCCACCGTGAGGCCCAGGGTGG + Intronic
1069948136 10:72001378-72001400 GGCCCCCAGTGGGCCCAAGCAGG + Intronic
1069975399 10:72208915-72208937 GCCCACTGGGAGGCCAAGGCGGG + Intronic
1072105990 10:92274592-92274614 GGACTTCGGGAGGCCCAGGCGGG + Intronic
1072650612 10:97292361-97292383 GGGCACCGGCAGGACCGAGCGGG + Intronic
1072916703 10:99541121-99541143 GGGCACGGGGAGGCCCCTGCAGG + Intergenic
1074380052 10:112972030-112972052 GGCCAGCGGGAGGCTAAAGCAGG - Intronic
1075544986 10:123348446-123348468 GGCCAGCCAGAGGCCCAGGCTGG - Intergenic
1075545634 10:123352325-123352347 GGCCAGAGGGAGGCCCAGGCAGG - Intergenic
1075714336 10:124547542-124547564 GGCCCCAGGGAGGCCCCAGGTGG - Intronic
1076116932 10:127907357-127907379 GCACCCCGGGAGGCCCAAGCAGG + Intronic
1076700709 10:132271237-132271259 TGCCACGTGGAGGCCGAAGCTGG - Intronic
1076713778 10:132353141-132353163 GGCCAGCGGGGGCCCCCAGCAGG + Intronic
1076820796 10:132938547-132938569 GCCCACCGGGAGGCCACAGAGGG + Intronic
1076970039 11:127770-127792 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1076970067 11:127870-127892 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1076970466 11:129435-129457 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1076970592 11:129937-129959 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1076970754 11:130744-130766 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1077094746 11:794544-794566 GGCCTCCGGCTGGCCCCAGCTGG - Intronic
1079100505 11:17538733-17538755 AGCCATCGGGAGGCACAAGCAGG + Intronic
1079428182 11:20363727-20363749 GGCCACCCGGAAGACCAAGCCGG + Exonic
1079505493 11:21148014-21148036 TGCCCCAGGGAGGCCCAAGAGGG - Intronic
1079920655 11:26429989-26430011 GCCCTTCGGGAGGCCAAAGCGGG + Intronic
1081783872 11:45732806-45732828 GGCCACTGGGAGACACAGGCAGG - Intergenic
1082260161 11:50072204-50072226 GGCCATCGGGAGGCAGGAGCTGG + Intergenic
1082260250 11:50072600-50072622 GGCCACCGGGAGGCAGGAGCTGG + Intergenic
1082260291 11:50072790-50072812 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1082260479 11:50073578-50073600 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1082260499 11:50073674-50073696 GGCCACTGTGAGGCCTGAGCTGG + Intergenic
1082260646 11:50074327-50074349 GTCCACCGGGAGGCTGCAGCTGG + Intergenic
1082261268 11:50077656-50077678 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1084002797 11:66306625-66306647 AGCTACCGGGAGGCCGAGGCAGG + Intergenic
1084174045 11:67414455-67414477 GGACATTGGGAGGCCGAAGCAGG + Intronic
1084488518 11:69464798-69464820 GACCACCGGGAGGCCCAGCCAGG + Intergenic
1084958915 11:72705987-72706009 GGCCACAGGCAGGCCCCAGGGGG + Intronic
1085102987 11:73817076-73817098 GCACTTCGGGAGGCCCAAGCGGG - Intronic
1085504983 11:77053292-77053314 AGGCACTGGGAGGCCCTAGCCGG + Intergenic
1085687186 11:78633789-78633811 TGCCATCTGGAGGCCCAAGGGGG + Intergenic
1087626651 11:100603718-100603740 GGGCACCTGGAGGCCCCAGCTGG - Intergenic
1089159090 11:116424057-116424079 GGACCCCGGGAGTCCCTAGCTGG + Intergenic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089401308 11:118166220-118166242 AGCCAACGGGAGCCCCAAGGAGG + Exonic
1090805725 11:130200938-130200960 GGCCACCGGCAAGCCAGAGCTGG - Intronic
1091420606 12:336592-336614 GAACACTGGGAGGCCGAAGCTGG + Intronic
1092143288 12:6198699-6198721 GGCCACCGAAAGGTTCAAGCAGG - Intergenic
1093462497 12:19419341-19419363 GCACATTGGGAGGCCCAAGCTGG + Intronic
1096792570 12:54054160-54054182 GGCCACGGGCCGGCCCAGGCGGG + Exonic
1098559615 12:71857194-71857216 GGACACTGGGAGGCCAAGGCAGG - Intronic
1100842993 12:98632098-98632120 GCACACTGGGAGGCCGAAGCAGG - Intronic
1101603334 12:106229436-106229458 GCCCACCGGGACTGCCAAGCTGG - Intergenic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1103562709 12:121800608-121800630 GGCGACCCGGCGGCCCACGCGGG - Intronic
1103649462 12:122422115-122422137 GGACCCCGGGAGGCCGAAGCCGG - Intronic
1104772411 12:131371769-131371791 GGCCAATGGGAGGCCTCAGCAGG - Intergenic
1105515982 13:21091084-21091106 GGGCTTCGGGAGGCCGAAGCAGG - Intergenic
1105808562 13:23973578-23973600 GGCCACTGGGAAGCCCCAACAGG - Intergenic
1105889138 13:24669485-24669507 GGACACAGTGAGGCTCAAGCTGG + Intergenic
1106128815 13:26922510-26922532 GGACACCGGGAGAGCCAGGCTGG - Intergenic
1106564308 13:30871569-30871591 GGCTGCAGGGAGGCCCCAGCTGG + Intergenic
1106774343 13:32994056-32994078 TGCCACCGGGATGGCCAAGTTGG - Intergenic
1112766763 13:102753962-102753984 GGTCTCTGGGAGGCCGAAGCAGG + Intronic
1113563906 13:111306168-111306190 GGTGGCCGGGAGGACCAAGCGGG + Intergenic
1114674697 14:24432224-24432246 GGGCACCGGGAGGCTCACGGTGG - Exonic
1116707336 14:48318961-48318983 GGCCACAGGGAGACCCAGGCTGG + Intergenic
1118377761 14:65191766-65191788 AGCCAACGGGAGGCACAAGAAGG - Intergenic
1119132998 14:72191914-72191936 GGCCACCCTGAGCCCCAAGGTGG + Intronic
1121343412 14:93118034-93118056 GGGCGCTGGGAGGCCGAAGCAGG + Intergenic
1121657151 14:95605449-95605471 AGACACAGGGAGGCACAAGCAGG - Intergenic
1122411454 14:101528139-101528161 GGCCACAGGGAGGGCCCAGGTGG + Intergenic
1122447630 14:101781336-101781358 TGCCACCGGGAGGCGCAGGGCGG - Intronic
1122650185 14:103221720-103221742 GGAAACCGGGAGGCTCAGGCAGG + Intergenic
1122785631 14:104162183-104162205 AGGCACCGGGAGGGCCCAGCAGG + Intronic
1202941302 14_KI270725v1_random:149234-149256 GCCCACTGGGAGGCCAAGGCGGG - Intergenic
1124176091 15:27425356-27425378 GGCCACTGGGAGGCCGAGGCAGG + Intronic
1124328033 15:28783834-28783856 GCACCCCGGGAGGCCGAAGCAGG - Intergenic
1128651187 15:69414697-69414719 GGCCCCTTGGAGGCCCAGGCGGG - Intronic
1129380532 15:75162537-75162559 GGACACTGGGAGGCCGAGGCAGG + Intergenic
1131487276 15:92831887-92831909 GGCTGCAGGGAGCCCCAAGCAGG - Intergenic
1131912634 15:97224532-97224554 GGCCACGCGGAAGCCCATGCGGG - Intergenic
1132140105 15:99385202-99385224 GGCCAGCGAGAGGCACCAGCAGG - Intronic
1132542735 16:518839-518861 GGTCACAGGGCGGCCCCAGCAGG + Intronic
1132557446 16:578845-578867 GGCCACCGTCAGGCCCAGGCAGG - Exonic
1132677206 16:1125755-1125777 GGCCAGCTGGAGCCCCGAGCAGG - Intergenic
1132833981 16:1943285-1943307 GGCCTCCCGGAGGCGGAAGCCGG - Exonic
1132877774 16:2148081-2148103 GGTCACCGGGAGGACACAGCGGG - Intronic
1133217248 16:4300116-4300138 GAGCTCCGGGAGGCCCAGGCAGG + Intergenic
1134823620 16:17266794-17266816 GGCCACTGGGAGGGACAAACAGG + Intronic
1135886269 16:26311319-26311341 GGCCAGCTGGAGGCACAACCAGG + Intergenic
1135887118 16:26320324-26320346 GCCCACTGGGAGGCTGAAGCTGG + Intergenic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1138503339 16:57462845-57462867 GGGCGCCGGGAGGCCCAAGCCGG + Intronic
1138588016 16:57984461-57984483 GGGGAGCGGGAGTCCCAAGCAGG - Intronic
1138629013 16:58278641-58278663 AGCCACGGGGAGCCCCAAGATGG + Intronic
1139153940 16:64418374-64418396 GAACACTGGGAGGCCTAAGCAGG + Intergenic
1141513905 16:84530350-84530372 GGCCAGTGGGAGGCACTAGCAGG + Intronic
1141976088 16:87517547-87517569 GGCCACAGGGCTGCCCAACCAGG - Intergenic
1142187441 16:88701232-88701254 GGCTCCAGGGCGGCCCAAGCAGG + Intronic
1142449496 16:90166742-90166764 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1142449656 16:90167545-90167567 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1142449783 16:90168047-90168069 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1142450610 16:90171262-90171284 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1142450638 16:90171362-90171384 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1142456924 17:62329-62351 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1142456952 17:62429-62451 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1142457303 17:63799-63821 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1142457432 17:64300-64322 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1142457597 17:65107-65129 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1142958446 17:3536340-3536362 GCACACTGGGAGGCCAAAGCAGG + Intronic
1143537360 17:7549251-7549273 GGCCAGCAGGAGGCCGAGGCAGG - Exonic
1145991995 17:29084972-29084994 GGGCAGAGGGAGGCCCCAGCGGG - Intronic
1146329729 17:31917340-31917362 GGCCTCTGGGGCGCCCAAGCGGG + Intergenic
1146371156 17:32266203-32266225 GGCCACCGCGGGGCCCGGGCTGG - Exonic
1147041143 17:37720019-37720041 GATCACCGGCAGGCCCAAGGAGG + Intronic
1147908264 17:43837654-43837676 GGACTCTGGGAGGCCGAAGCAGG + Intergenic
1148327106 17:46789755-46789777 GCCCAGCTGGAGGTCCAAGCTGG - Intronic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1149993846 17:61396942-61396964 TGCCACCTGGAGGCTCAACCCGG + Intergenic
1150437861 17:65167969-65167991 GGCCACCGGGAGGATGAAGTGGG + Intronic
1151586373 17:75011125-75011147 GGCCACCAGATGGCCCAAGCAGG + Intergenic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151714595 17:75824985-75825007 GGCCTCAGGGAGGCCCGAGGGGG + Exonic
1151963344 17:77418968-77418990 GGCAACCAGGAGGCTCAGGCAGG - Intronic
1152595933 17:81237608-81237630 GGCCACAGGGAGGCTGCAGCAGG + Intronic
1152727570 17:81955364-81955386 GGGCCCCGGGAGCCCCACGCCGG - Intronic
1158341673 18:56473081-56473103 GGACTTCGGGAGGCCGAAGCGGG - Intergenic
1159099365 18:63940844-63940866 AGCCACCAGGAGGCTCAAACTGG + Intergenic
1160646837 19:197688-197710 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1160646865 19:197788-197810 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1160647662 19:200904-200926 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1160983454 19:1827100-1827122 CGCCTCCGGGAAGCCCAGGCTGG + Exonic
1161232226 19:3180068-3180090 GGCCACCGGGAAGACCATGGGGG - Exonic
1161450562 19:4343421-4343443 GGCCTCGGGGATGCCCACGCGGG - Intergenic
1161571412 19:5032746-5032768 GGCCACCAGGAGGACAAAGGCGG - Intronic
1162119730 19:8456250-8456272 TGCCACCAGGAGGCCCGAGGAGG + Intronic
1163626672 19:18394116-18394138 GGGAACAGGGAGGGCCAAGCAGG - Intronic
1163793282 19:19320812-19320834 CGCCACAGGGAGGCGGAAGCAGG - Exonic
1164596599 19:29534285-29534307 GGCCAAAGGGAGGCCCAGACAGG - Intronic
1164979036 19:32599031-32599053 GCACACTGGGAGGCCAAAGCGGG + Intronic
1165180470 19:33963192-33963214 GCCCACAGGGAGGCCTAAGCAGG + Intergenic
1165701981 19:37945344-37945366 AGCTACCGGGAGGCTGAAGCAGG - Intronic
1166010295 19:39936266-39936288 GGCCTCTGGGAGGCCAGAGCGGG + Intergenic
1166166230 19:40991119-40991141 GGTCACTGGGTTGCCCAAGCAGG + Intergenic
1166292232 19:41870510-41870532 GGCCACAGGGAGGCCAAGACAGG - Intronic
1167621675 19:50564308-50564330 GTCCTCCGGGCGGCCCAAGAGGG - Intronic
1167640122 19:50676839-50676861 GCCAACCGGGATGCCCAAGTGGG + Intronic
1168706073 19:58470984-58471006 CGCCCTCGGGAGGCCTAAGCGGG - Exonic
925012402 2:495906-495928 AGCCACCGGGATCCCCAGGCTGG + Intergenic
927178208 2:20424907-20424929 GGCCTCTGGCAAGCCCAAGCTGG - Intergenic
927638768 2:24834000-24834022 GGCCTCCTGGAGTCCCCAGCTGG - Intronic
931435280 2:62240541-62240563 AGCCACCGGGAGGCTGAGGCAGG + Intergenic
933478477 2:82822427-82822449 GGACTCTGGGAGGCCCAGGCAGG + Intergenic
933682388 2:85113691-85113713 GCACACTGGGAGGCCAAAGCAGG + Intergenic
934717139 2:96550685-96550707 GGCCACCGAGAGGCCGAAGAAGG + Exonic
934721589 2:96581177-96581199 GCACTCCGGGAGGCCGAAGCAGG + Intergenic
936512216 2:113157496-113157518 GGCCCGCGGGAGGCCGGAGCAGG + Intronic
937172096 2:119884009-119884031 GGCTACCGGGAGGCTGAGGCAGG - Intronic
937225483 2:120366437-120366459 GGCGATAGGGAGGTCCAAGCAGG + Intergenic
937312394 2:120910212-120910234 GACCACCGGGAGGCCCCAAACGG - Intronic
937958834 2:127439238-127439260 GCCCTCTGGGAGGCCAAAGCAGG - Intronic
938240718 2:129740746-129740768 GGCCTCCGGAAGGCTCCAGCAGG + Intergenic
938660563 2:133482462-133482484 GGACACTGGGAGGCCAAGGCAGG - Intronic
940227007 2:151410398-151410420 GGCCACCCTGAGGCCCGAACCGG - Exonic
941933321 2:170963889-170963911 GCACACTGGGAGGCCAAAGCAGG - Intronic
942004042 2:171679799-171679821 GGCCAACGGGAAGCCCCAGGAGG + Intergenic
942475128 2:176311558-176311580 AGCCACCTGGAGGCTCAAACTGG - Intronic
944461662 2:199955997-199956019 GGCCACCGGGAGCCCTGGGCAGG - Exonic
944674473 2:202023613-202023635 GGCCACCGAGAGGCCAAAACTGG - Intergenic
945969444 2:216221548-216221570 GGCCACTGGCAGGCGCATGCAGG + Intergenic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
946177304 2:217929520-217929542 GGCCACAGGGAAGCACCAGCAGG + Intronic
946857417 2:223965981-223966003 AGCCACTGGGAGGCCAAGGCGGG + Intronic
946865523 2:224038846-224038868 GCCCGCCGGGAGCCCCGAGCGGG - Intronic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
947540983 2:230977935-230977957 TGCCACTGGGAGGCTGAAGCAGG - Intergenic
947714670 2:232333571-232333593 GGCATCTGGGAGGCCCAGGCAGG + Intronic
948087726 2:235265531-235265553 GGCCAGCTGGAGGCCCTGGCAGG + Intergenic
948873705 2:240816781-240816803 GGCCTGCAGGAGGCCAAAGCTGG + Intronic
948987679 2:241535148-241535170 GGGCACCAGGAGGCCCAGGGTGG + Intergenic
1169488731 20:6054094-6054116 GGCCAGGGGCAGGCCCTAGCGGG - Intergenic
1170931445 20:20772584-20772606 GGCCACTGGGAGGGCTAAGTGGG + Intergenic
1171935648 20:31272625-31272647 GCCCACCTGGGGGCCCAAGGAGG + Intergenic
1172165121 20:32894187-32894209 GGCCACCAGGGGCCCCATGCAGG + Intronic
1172517038 20:35542178-35542200 CGCCACCGGTAGGCCGCAGCGGG + Exonic
1174046956 20:47740524-47740546 GGCCACTGGGAGCTCCAGGCAGG + Intronic
1174383513 20:50172483-50172505 GGCCAACGGGAGGCCCCGGTCGG + Intergenic
1175487789 20:59357695-59357717 GGGCACCTGGTGGCCCAAGAAGG + Intergenic
1175993898 20:62804012-62804034 GGCCACCGGGAGGGTCACCCTGG - Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176581862 21:8537701-8537723 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1177647877 21:23922591-23922613 GCCCACTGGGAGGCCGAGGCAGG + Intergenic
1178632621 21:34275872-34275894 GGCCATCGAGTGGCCGAAGCAGG + Intergenic
1179721735 21:43320258-43320280 GGCCATGGGGAGGCCAAGGCTGG + Intergenic
1180061734 21:45388742-45388764 ATCCACAGGGAGGCCCCAGCAGG + Intergenic
1180264697 22:10514773-10514795 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1180710949 22:17839193-17839215 GTACTCCGGGAGGCCAAAGCAGG - Intronic
1181033349 22:20158544-20158566 GCCCACCTGGAGGCTCCAGCGGG - Intergenic
1181460041 22:23080405-23080427 GGACACTGGGAGGCCCAGCCGGG + Intronic
1181514351 22:23402631-23402653 GCCCACCGCGAGGCCCAGCCCGG - Intergenic
1182098569 22:27642174-27642196 GGGCAGGGGGAGGCCCCAGCAGG + Intergenic
1182336441 22:29586506-29586528 GCACACTGGGAGGCCCAGGCAGG + Intergenic
1182787634 22:32920809-32920831 GGCCAAAGTGAGGCCCCAGCAGG + Intronic
1183132804 22:35855776-35855798 GCCCACTGGGAGGCTCAGGCAGG + Intronic
1183318398 22:37149280-37149302 GGCCTCTGGGAGCCCCAGGCTGG - Intronic
1183582738 22:38735484-38735506 GGGCACTGGCAGGCCCTAGCAGG + Exonic
1184118637 22:42436488-42436510 GGCCACTGCGAGGCACAAGACGG - Intergenic
1184778184 22:46633607-46633629 TGCCAACGGGAGTCCCCAGCTGG + Intronic
1185191383 22:49438667-49438689 GGCCTCAGGGAGGCTCAAGAGGG - Intronic
1185404961 22:50642512-50642534 GGCCACCAGGGGGCCTAAGGTGG - Intergenic
950080611 3:10219562-10219584 GCACACTGGGAGGCCCAGGCAGG - Intronic
950099110 3:10346341-10346363 GGCCACAGGGGGCCCCAAGTCGG - Intronic
950320522 3:12048412-12048434 GGCCTTTGGGAGGCCAAAGCAGG - Intronic
952377672 3:32780979-32781001 CGCCTCCGGGAGGCCGAGGCAGG - Intergenic
953443605 3:42942024-42942046 AGCCACAGGGAGTCCTAAGCAGG + Exonic
958258054 3:91347838-91347860 GCACACTGGGAGGCCCAGGCAGG + Intergenic
958717504 3:97803206-97803228 GGCCGTTGGGAGGCCAAAGCAGG + Intergenic
960023004 3:112976565-112976587 GGACACTGGGAGGCCGAGGCGGG + Intergenic
960937603 3:122913110-122913132 AGCCCCGGGGAGGCCCAGGCCGG - Intronic
961357512 3:126348448-126348470 GGCCACCTGGTGGTCCTAGCTGG - Intronic
961756086 3:129128182-129128204 CCCCACCTGCAGGCCCAAGCTGG + Intronic
961828828 3:129612874-129612896 GGCCACCGAGCCGCCCAAGTTGG + Intergenic
962147549 3:132856377-132856399 GCCCACCAGGAGGCACAAGGGGG + Intergenic
964798808 3:160530220-160530242 GCACACTGGGAGGCCAAAGCAGG + Intronic
967666563 3:192179790-192179812 GCACCCCGGGAGGCCAAAGCAGG - Intronic
967974629 3:195026233-195026255 GGACACTGGGAGGCCGAGGCGGG + Intergenic
968008766 3:195259887-195259909 GGCCCCGGGGAGGACCAGGCAGG + Intronic
968077663 3:195825276-195825298 GGCGACCGCGAGGCCGAGGCAGG - Intergenic
968226396 3:196975013-196975035 GGCCACCGAGAGGCTTAGGCAGG + Intergenic
968370185 3:198219211-198219233 GGCCACCGTGAGGCCTGACCTGG - Intergenic
968370816 3:198221734-198221756 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
968370844 3:198221834-198221856 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
968443141 4:634511-634533 GGCCACCGGGCGGTGAAAGCTGG - Intronic
968578603 4:1379329-1379351 GCCCACCTGGATGCCCAGGCAGG - Intronic
968629956 4:1645188-1645210 TGCCACAGGGAGGCACAGGCCGG + Intronic
968656302 4:1779815-1779837 GGCCACATGGTGGCCCAGGCTGG - Intergenic
968994799 4:3938663-3938685 GGCCAGCGGGAGGCTCAGGGAGG + Intergenic
969395889 4:6921024-6921046 GCACACTGGGAGGCCGAAGCAGG - Intronic
969724516 4:8911342-8911364 GGCCACCGTGAGGAACAAGCAGG - Intergenic
972222028 4:36966758-36966780 GGCCACTGGGAAGCTCTAGCTGG - Intergenic
973176459 4:47212245-47212267 GGCCAATGGGAGACCCAGGCAGG - Intronic
978888614 4:113796157-113796179 GGACATCGGGAGGCCGAGGCGGG - Intergenic
979259274 4:118633368-118633390 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
979259318 4:118633557-118633579 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
979259362 4:118633723-118633745 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
979259493 4:118634225-118634247 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
979259521 4:118634323-118634345 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
979259537 4:118634386-118634408 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
979328835 4:119406239-119406261 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
979328863 4:119406338-119406360 GGCCACCGTGAGGCCTGACCTGG + Intergenic
979329014 4:119406943-119406965 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
979329032 4:119407006-119407028 GGCCACCGGGAGGCAGGAGCTGG + Intergenic
979668917 4:123342038-123342060 GTCCACTGGGAGGCCAAGGCAGG - Intergenic
983229127 4:165112467-165112489 GGCCCCCGGGGGTCCCAGGCTGG - Intronic
985517640 5:355131-355153 GGGCACCAGGAGGCCCAGGCTGG - Intronic
985535765 5:465020-465042 AGCCACCGGGAGCCCCAGCCTGG + Intronic
985724000 5:1506204-1506226 GGCCTCTGGGAGCCCCAGGCAGG + Intronic
987275257 5:16355475-16355497 GGACTCTGGGAGGCCGAAGCGGG - Intergenic
991042264 5:62188254-62188276 GGCCAATGGGAGGCCAAGGCAGG - Intergenic
992078568 5:73214017-73214039 GGCTACCAGGAGGCCCAGGGAGG + Intergenic
996911836 5:128665507-128665529 GGCCAATGGGAGGCACAAACAGG + Intronic
997865852 5:137462148-137462170 GGCCACCAGGAGGCCACATCTGG + Intronic
997960212 5:138315167-138315189 GCACACTGGGAGGCCGAAGCGGG - Intronic
1000998935 5:167986851-167986873 GGTCACAGGGAGGACCAAGAGGG - Intronic
1001388824 5:171361878-171361900 GCACTTCGGGAGGCCCAAGCGGG + Intergenic
1001422694 5:171599549-171599571 GCCCCCTGGGAGGCCCAGGCCGG + Intergenic
1001437861 5:171714592-171714614 GGACTCCCAGAGGCCCAAGCCGG + Intergenic
1001588611 5:172850361-172850383 GGGCAGGCGGAGGCCCAAGCAGG - Intronic
1002057742 5:176608512-176608534 GGCCCCAGAGTGGCCCAAGCTGG - Intronic
1002080557 5:176734760-176734782 GGCCACTGTGATGGCCAAGCTGG + Intergenic
1002090096 5:176799215-176799237 GACCCCTGGGAGACCCAAGCAGG - Intergenic
1002117517 5:176974905-176974927 CAACACTGGGAGGCCCAAGCTGG + Intronic
1002196301 5:177503488-177503510 GGAGACCCGGAGGCCCGAGCTGG - Intronic
1002314520 5:178334410-178334432 GGCCACCGGGCGGCACCGGCCGG + Intronic
1002729419 5:181324660-181324682 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1002729583 5:181325467-181325489 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1002729711 5:181325969-181325991 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1002730050 5:181327290-181327312 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1002730078 5:181327390-181327412 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1006405728 6:33843691-33843713 GGCCAGTGGGAGGCACCAGCAGG + Intergenic
1006447189 6:34086238-34086260 GGGCAGCAGGAGGCCCAGGCTGG - Intronic
1007183007 6:39944119-39944141 AGCCACCGGGAGGCTGAGGCAGG - Intergenic
1008528986 6:52436886-52436908 GCACACCGGGAGGCCAAGGCAGG - Intronic
1008997202 6:57672871-57672893 GCACACTGGGAGGCCCAGGCAGG - Intergenic
1009185716 6:60572200-60572222 GCACACTGGGAGGCCCAGGCAGG - Intergenic
1013029879 6:106323029-106323051 AGCCACTGGGAGGCTGAAGCAGG - Intronic
1013908899 6:115250548-115250570 AGCCACCGGGAAGCTCAAACTGG + Intergenic
1015969289 6:138728280-138728302 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1019554186 7:1620383-1620405 AGCCACCGGGAGGCCGAGGCAGG - Intergenic
1020288828 7:6706782-6706804 GGCCAGGCGGAGGCTCAAGCGGG - Exonic
1023400937 7:39792753-39792775 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1023400964 7:39792852-39792874 GGTCGCCGGGAGGCCCAAGCTGG - Intergenic
1023401002 7:39793016-39793038 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1023401221 7:39793849-39793871 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1023401248 7:39793948-39793970 GGCTGCCGGGAGGCCCAAGCTGG - Intergenic
1023401264 7:39794011-39794033 GGCCGCCGGGAGGCTGGAGCTGG - Intergenic
1023781300 7:43658245-43658267 GGGCACCGGGAGGCGGAGGCAGG + Intronic
1023954392 7:44872487-44872509 GGCACCCGGCAGGCCCAGGCAGG + Intergenic
1024073744 7:45808097-45808119 GGCCACCGTGAGGCAAGAGCTGG - Intergenic
1024073936 7:45809116-45809138 GGCTGCCGGGAGGCCGAAGGTGG - Intergenic
1024074182 7:45810414-45810436 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1024074226 7:45810603-45810625 GGGCACCGGGAGGCAGGAGCTGG - Intergenic
1024074247 7:45810666-45810688 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1024074272 7:45810769-45810791 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1024074388 7:45811222-45811244 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074414 7:45811321-45811343 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024074721 7:45812580-45812602 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074747 7:45812679-45812701 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024075210 7:45814494-45814516 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024075238 7:45814593-45814615 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1024517548 7:50272179-50272201 GGCCAGCAGGGGTCCCAAGCTGG - Intergenic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024648365 7:51386733-51386755 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1024648394 7:51386832-51386854 GGCCACCGTGAGGCCGGAGCTGG + Intergenic
1024648630 7:51387761-51387783 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1024648668 7:51387925-51387947 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1024648695 7:51388024-51388046 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1024648881 7:51388743-51388765 GGCCACCGGGAGGCTGGAGCTGG + Intergenic
1024648897 7:51388806-51388828 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1024648926 7:51388905-51388927 GGCCACCGTGAGGCCGGAGCTGG + Intergenic
1024649062 7:51389429-51389451 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1024649105 7:51389595-51389617 GGCCGCCGGGAGGCAAGAGCTGG + Intergenic
1024649148 7:51389784-51389806 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1024649395 7:51391082-51391104 GGCTGCCGGGAGGCCGAAGGTGG + Intergenic
1024649590 7:51392103-51392125 GGCCACCGTGAGGCATGAGCTGG + Intergenic
1025052200 7:55741139-55741161 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025052214 7:55741202-55741224 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025052242 7:55741301-55741323 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052578 7:55742586-55742608 GGCCACCGGGAGGCAGTAGGTGG + Intergenic
1025052613 7:55742750-55742772 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025052640 7:55742849-55742871 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052997 7:55744207-55744229 GGTCACCGGGAGGCCCAAGCTGG + Intergenic
1025053024 7:55744306-55744328 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025053140 7:55744759-55744781 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025053166 7:55744862-55744884 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025053229 7:55745114-55745136 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025053671 7:55747433-55747455 GGCCACCGTGAGGCAAGAGCTGG + Intergenic
1025129155 7:56366822-56366844 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025129171 7:56366885-56366907 GGCCGCCGGGAGGCGCAAGATGG + Intergenic
1025129199 7:56366984-56367006 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025129897 7:56369757-56369779 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025129923 7:56369856-56369878 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130049 7:56370369-56370391 GGCCACCGTGAGGGAGAAGCAGG - Intergenic
1025130195 7:56370986-56371008 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130222 7:56371085-56371107 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130515 7:56372284-56372306 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130542 7:56372383-56372405 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130833 7:56373578-56373600 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130860 7:56373677-56373699 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025131153 7:56374875-56374897 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025131179 7:56374972-56374994 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025131332 7:56375587-56375609 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025131774 7:56377907-56377929 GGCCACCGTGAGGCAAGAGCTGG + Intergenic
1025175885 7:56802283-56802305 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025176058 7:56803059-56803081 GGCTGCCGGGAGTCCCAAGCTGG + Intergenic
1025176080 7:56803154-56803176 GGCCACAGTGAGGCCCGAGCTGG + Intergenic
1025176273 7:56803990-56804012 GGCTACCGTGAGGCCTGAGCTGG - Intergenic
1025176302 7:56804089-56804111 GGCCGCTGGGAGGCCCAAGCTGG - Intergenic
1025176318 7:56804152-56804174 GGCCACCGGGAGGCCGGAGCTGG - Intergenic
1025176514 7:56804879-56804901 GGCCTCCGCGAGGCACCAGCTGG - Intergenic
1025177579 7:56809860-56809882 GGCTGCCGGGAGGCCGGAGCTGG + Intergenic
1025177595 7:56809923-56809945 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1025177618 7:56810022-56810044 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025177788 7:56810727-56810749 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025177923 7:56811259-56811281 GGCCACCGGGAGGCATGAGCTGG + Intergenic
1025177943 7:56811362-56811384 GGCCGCCGAGAGGCCAGAGCTGG + Intergenic
1025178129 7:56812135-56812157 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025178190 7:56812394-56812416 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178219 7:56812493-56812515 GGCCACCATGAGGCCCGAGCTGG + Intergenic
1025178354 7:56813013-56813035 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025178376 7:56813116-56813138 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025178559 7:56813874-56813896 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025178589 7:56813970-56813992 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025178624 7:56814136-56814158 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178806 7:56814858-56814880 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025178997 7:56815664-56815686 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179027 7:56815760-56815782 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179060 7:56815926-56815948 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179089 7:56816025-56816047 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025179222 7:56816545-56816567 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179244 7:56816648-56816670 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025179453 7:56817550-56817572 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179483 7:56817646-56817668 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179515 7:56817812-56817834 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179544 7:56817911-56817933 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025179679 7:56818431-56818453 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179702 7:56818534-56818556 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025179902 7:56819388-56819410 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179932 7:56819484-56819506 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179965 7:56819650-56819672 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179994 7:56819749-56819771 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180128 7:56820269-56820291 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180150 7:56820372-56820394 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025180377 7:56821370-56821392 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025180407 7:56821466-56821488 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025180439 7:56821632-56821654 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180467 7:56821731-56821753 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180599 7:56822251-56822273 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180621 7:56822354-56822376 GGCCACCGAGAGGCCGGAGCTGG + Intergenic
1025180820 7:56823208-56823230 GGCCGCCGTGAGGCCAGAGCTGG + Exonic
1025180850 7:56823304-56823326 GGCCACCGGGAGGCAGGAGGTGG + Exonic
1025180884 7:56823481-56823503 GGCCGCCGGGAGGCCCAAGCTGG + Exonic
1025180913 7:56823580-56823602 GGCCACCGTGAGGCCTGAGCTGG + Intronic
1025181066 7:56824201-56824223 GGCCGCCGAGAGGCCGGAGCTGG + Intronic
1025181247 7:56824959-56824981 GGCCGCCGTGAGGCCAGAGCTGG + Intronic
1025181277 7:56825055-56825077 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025181312 7:56825221-56825243 GGCCGCCGGGAGGCCCAACCTGG + Intronic
1025181340 7:56825320-56825342 GGCCACCGTGAGGCCTGAGCTGG + Intronic
1025181473 7:56825840-56825862 GGCCGCCGGGAGGCATGAGCTGG + Intronic
1025181495 7:56825943-56825965 GGCCGCCGAGAGGCCGGAGCTGG + Intronic
1025181695 7:56826797-56826819 GGCCGCCGTGAGGCCAGAGCTGG + Intronic
1025181723 7:56826893-56826915 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025181756 7:56827059-56827081 GGCCGCCGGGAGGCCCAAGCTGG + Intronic
1025181786 7:56827158-56827180 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025182061 7:56828304-56828326 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025182787 7:56832107-56832129 GGCCACCGTGAGGCGTGAGCTGG + Intergenic
1025288655 7:57691224-57691246 GCCCACTGGGAGGCCAAGGCGGG - Intergenic
1025689139 7:63744867-63744889 GGCCACCGTGAGGCATGAGCTGG - Intergenic
1025689787 7:63748339-63748361 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1025690131 7:63749837-63749859 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025690159 7:63749936-63749958 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690194 7:63750102-63750124 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025690418 7:63751037-63751059 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025690440 7:63751140-63751162 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025690578 7:63751660-63751682 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025690606 7:63751759-63751781 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690641 7:63751925-63751947 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025690888 7:63752963-63752985 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691027 7:63753483-63753505 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691056 7:63753582-63753604 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691092 7:63753748-63753770 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691306 7:63754635-63754657 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025691328 7:63754738-63754760 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691462 7:63755259-63755281 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691491 7:63755358-63755380 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691526 7:63755524-63755546 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691745 7:63756459-63756481 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025691767 7:63756562-63756584 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691902 7:63757082-63757104 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691931 7:63757181-63757203 GGCCGCCGGGAGGCCCAAGCTGG - Exonic
1025691966 7:63757347-63757369 GGCCACCGGGAGGCAGGAGGTGG - Exonic
1025692192 7:63758282-63758304 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025692214 7:63758385-63758407 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692350 7:63758905-63758927 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025692379 7:63759004-63759026 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692415 7:63759170-63759192 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025692660 7:63760208-63760230 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692794 7:63760728-63760750 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025692823 7:63760827-63760849 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692859 7:63760993-63761015 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693054 7:63761784-63761806 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025693076 7:63761887-63761909 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693211 7:63762407-63762429 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025693240 7:63762506-63762528 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693275 7:63762672-63762694 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693500 7:63763607-63763629 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025693522 7:63763710-63763732 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693654 7:63764230-63764252 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025693683 7:63764329-63764351 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693718 7:63764495-63764517 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693963 7:63765509-63765531 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025694137 7:63766217-63766239 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025694162 7:63766316-63766338 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694179 7:63766379-63766401 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
1025695278 7:63771507-63771529 GGCCTCCGCGAGGCACGAGCTGG + Intergenic
1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG + Intergenic
1025695490 7:63772333-63772355 GGCCGCTGGGAGGCCCAAGCTGG + Intergenic
1025695519 7:63772432-63772454 GGCTACCGTGAGGCCTGAGCTGG + Intergenic
1025695714 7:63773268-63773290 GGCCACAGTGAGGCCCGAGCTGG - Intergenic
1025695736 7:63773363-63773385 GGCTGCCGGGAGTCCCAAGCTGG - Intergenic
1025695908 7:63774139-63774161 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1025912247 7:65838533-65838555 GGCCACTGGGAGGCAAAAGGTGG - Intergenic
1025912280 7:65838695-65838717 GGCCACCTGGAGGCAGCAGCTGG - Intergenic
1025912778 7:65841176-65841198 GGCCACCAGGAGGCAGGAGCTGG - Intergenic
1025976724 7:66376542-66376564 GGCCACCGCGAGGCATGAGCTGG + Intronic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1026045737 7:66904307-66904329 GGCCGCCGCGAGGCACGAGCTGG - Intergenic
1026571152 7:71532197-71532219 TGCCAATGGGAGGCACAAGCAGG - Intronic
1026747212 7:73022775-73022797 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026750862 7:73050918-73050940 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026754511 7:73079028-73079050 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026758163 7:73107061-73107083 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026841296 7:73671218-73671240 GGCCCCCGGGCGGCCCCAGTGGG - Exonic
1026957890 7:74389277-74389299 GGCCACAGGGAGGACCCAGCCGG - Intronic
1027033316 7:74907346-74907368 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1027089242 7:75286423-75286445 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027092885 7:75314351-75314373 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027096528 7:75342318-75342340 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027118760 7:75501089-75501111 GCACACTGGGAGGCCAAAGCAGG - Intergenic
1027202346 7:76072002-76072024 GGCCACCGTGAGGCTTGAGCTGG + Intergenic
1027202639 7:76073182-76073204 GGCCACCGTGAGGCGTCAGCTGG + Intergenic
1027202943 7:76074314-76074336 GGCCACCGCAAGGCACAAGCTGG + Intergenic
1027322819 7:77025362-77025384 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1027326485 7:77053454-77053476 GCACACTGGGAGGCCAAAGCAGG + Intergenic
1027468534 7:78544903-78544925 GCCCTTCGGGAGGCCAAAGCAGG - Intronic
1028340954 7:89719184-89719206 AGCCACAGGGAAGCCCAAACTGG + Intergenic
1029134497 7:98359515-98359537 GCACACTGGGAGGCCGAAGCGGG - Intronic
1029397636 7:100319292-100319314 GCACACTGGGAGGCCGAAGCAGG - Intronic
1029718727 7:102348928-102348950 GCACACTGGGAGGCCAAAGCAGG + Intergenic
1029753888 7:102560327-102560349 GCACACTGGGAGGCCAAAGCAGG - Intronic
1029771838 7:102659417-102659439 GCACACTGGGAGGCCAAAGCAGG - Intronic
1031579303 7:123451643-123451665 GGCCAGCGGGAAACCCAAGCAGG + Intergenic
1032051304 7:128652588-128652610 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1032051430 7:128653090-128653112 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1032051719 7:128654214-128654236 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1032051763 7:128654376-128654398 GGCCGCTGGGAGGCCGGAGCTGG - Intergenic
1032591835 7:133199140-133199162 GCACATTGGGAGGCCCAAGCAGG - Intergenic
1032780586 7:135162315-135162337 GGCCTCCTGGAAGCCCCAGCAGG - Intronic
1035206082 7:157294795-157294817 GCCCTTCGGGAGGCCAAAGCGGG - Intergenic
1035207634 7:157304492-157304514 GGCCACCAGGTTGCCCAAGGTGG - Intergenic
1036270715 8:7300462-7300484 GGCCACAGGGAGTCGTAAGCAGG + Intergenic
1036350635 8:8009882-8009904 GGCCACAGGGAGTCGTAAGCAGG - Intergenic
1036695538 8:10972155-10972177 GGTCACCCCGAGGCCCCAGCTGG - Intronic
1037768736 8:21787065-21787087 CACCACCGGGAGTCCCAGGCAGG - Intronic
1039745532 8:40422810-40422832 GACCACAGGGAGCCCCAGGCAGG + Intergenic
1039923485 8:41909002-41909024 GGCCACGGGGAGGCACAGGGAGG - Intergenic
1040291578 8:46128242-46128264 GGCCACAGGGTGGCGTAAGCAGG - Intergenic
1041908471 8:63060469-63060491 GGACTCTGGGAGGCCGAAGCAGG + Exonic
1043061292 8:75507503-75507525 GCCCACTGGGAGGCCAAGGCAGG - Intronic
1044878953 8:96702316-96702338 GGCCTTCGGGAGGCCCACACGGG - Intronic
1047215082 8:122869583-122869605 TGTCGCCGGGAGGCCCAGGCAGG + Intronic
1050554588 9:6778334-6778356 GGACTTTGGGAGGCCCAAGCGGG - Intronic
1055160457 9:73120293-73120315 GGCCAAAGGAAGGCACAAGCAGG - Intergenic
1056710785 9:88990951-88990973 GCCCACCTGCAAGCCCAAGCCGG + Exonic
1057337315 9:94166220-94166242 GGTCGCCGGGAGGCCGATGCAGG - Intergenic
1058836494 9:108862499-108862521 AGCCAAGGAGAGGCCCAAGCAGG + Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060609978 9:124954917-124954939 GCACACTGGGAGGCCAAAGCAGG + Intronic
1060732627 9:126048081-126048103 GGCCACTGGGAGGAACAGGCGGG - Intergenic
1060796036 9:126513847-126513869 GGCCACGGGGAAGCCCCACCAGG + Intergenic
1060822486 9:126669508-126669530 GCCCACACGGATGCCCAAGCAGG - Intronic
1060865139 9:126989450-126989472 GTCTTCAGGGAGGCCCAAGCCGG - Intronic
1060994857 9:127870113-127870135 GGACACCTGGAGGCCACAGCAGG + Intronic
1061045696 9:128163757-128163779 GGCCAAGGGGAGGCCCAGGCAGG - Exonic
1062497871 9:136840097-136840119 GGCCAACGGGGACCCCAAGCTGG - Intronic
1062538677 9:137031945-137031967 GCCCTCGGGGAGGCCCAAGCTGG - Intronic
1062754125 9:138278481-138278503 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1062754465 9:138279804-138279826 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1062754493 9:138279904-138279926 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203577391 Un_KI270745v1:19929-19951 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1203577683 Un_KI270745v1:21238-21260 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1203578369 Un_KI270745v1:23964-23986 GGCCACCACGAGGCCTGAGCTGG - Intergenic
1203578397 Un_KI270745v1:24064-24086 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203611879 Un_KI270749v1:15737-15759 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1187223823 X:17356332-17356354 AGCCAATGGGAGGCCCCAGCAGG - Intergenic
1187571806 X:20511637-20511659 GGCCAATGGGAAGCCCCAGCAGG + Intergenic
1188578509 X:31681847-31681869 GGTCTCTGGGAGGCCAAAGCGGG + Intronic
1189807388 X:44749472-44749494 GGCCTTTGGGAGGCCCAGGCGGG - Intergenic
1190958334 X:55219867-55219889 GCCCTTTGGGAGGCCCAAGCGGG - Intronic
1196097700 X:111817436-111817458 AGCTACTGGGAGGCCGAAGCAGG - Intronic
1200065553 X:153502719-153502741 GGTCACCAGGAGGCCCCTGCTGG - Intronic
1202381009 Y:24276591-24276613 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1202381034 Y:24276690-24276712 GGCTACCAGGAGGCCCAAGCTGG - Intergenic
1202381072 Y:24276849-24276871 GGCCACCGAGAGGACGGAGCTGG - Intergenic
1202489713 Y:25393277-25393299 GGCCACCGAGAGGACGGAGCTGG + Intergenic
1202489751 Y:25393436-25393458 GGCTACCAGGAGGCCCAAGCTGG + Intergenic
1202489776 Y:25393535-25393557 GGCCACCGTGAGGCCTGAGCTGG + Intergenic