ID: 1032052737

View in Genome Browser
Species Human (GRCh38)
Location 7:128658862-128658884
Sequence CCCACGGAAGTGGGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032052724_1032052737 4 Left 1032052724 7:128658835-128658857 CCCCCTCCTCAGCCAAGGCAGCT No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052727_1032052737 1 Left 1032052727 7:128658838-128658860 CCTCCTCAGCCAAGGCAGCTTGG No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052720_1032052737 30 Left 1032052720 7:128658809-128658831 CCTGGCAGGGGCTCACACCTCCT No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052721_1032052737 13 Left 1032052721 7:128658826-128658848 CCTCCTCAGCCCCCTCCTCAGCC No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052726_1032052737 2 Left 1032052726 7:128658837-128658859 CCCTCCTCAGCCAAGGCAGCTTG No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052731_1032052737 -8 Left 1032052731 7:128658847-128658869 CCAAGGCAGCTTGGACCCACGGA No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052725_1032052737 3 Left 1032052725 7:128658836-128658858 CCCCTCCTCAGCCAAGGCAGCTT No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052729_1032052737 -2 Left 1032052729 7:128658841-128658863 CCTCAGCCAAGGCAGCTTGGACC No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data
1032052722_1032052737 10 Left 1032052722 7:128658829-128658851 CCTCAGCCCCCTCCTCAGCCAAG No data
Right 1032052737 7:128658862-128658884 CCCACGGAAGTGGGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032052737 Original CRISPR CCCACGGAAGTGGGGATGGA AGG Intergenic
No off target data available for this crispr