ID: 1032058528

View in Genome Browser
Species Human (GRCh38)
Location 7:128704207-128704229
Sequence GTCTTTCCACAGATGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032058524_1032058528 2 Left 1032058524 7:128704182-128704204 CCAGGAACTGGTTTCTTGGAAGA No data
Right 1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG No data
1032058518_1032058528 19 Left 1032058518 7:128704165-128704187 CCCCAACCTTTTTGGCACCAGGA 0: 84
1: 1119
2: 1648
3: 1294
4: 915
Right 1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG No data
1032058522_1032058528 13 Left 1032058522 7:128704171-128704193 CCTTTTTGGCACCAGGAACTGGT 0: 57
1: 564
2: 848
3: 1236
4: 1222
Right 1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG No data
1032058520_1032058528 17 Left 1032058520 7:128704167-128704189 CCAACCTTTTTGGCACCAGGAAC 0: 92
1: 1093
2: 1728
3: 1438
4: 978
Right 1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG No data
1032058519_1032058528 18 Left 1032058519 7:128704166-128704188 CCCAACCTTTTTGGCACCAGGAA 0: 87
1: 1130
2: 1680
3: 1373
4: 955
Right 1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032058528 Original CRISPR GTCTTTCCACAGATGGAGGG TGG Intergenic
No off target data available for this crispr