ID: 1032059162

View in Genome Browser
Species Human (GRCh38)
Location 7:128709327-128709349
Sequence ACATAAGTATGTGCAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032059162_1032059164 30 Left 1032059162 7:128709327-128709349 CCTTTATTTGCACATACTTATGT 0: 1
1: 0
2: 0
3: 23
4: 280
Right 1032059164 7:128709380-128709402 TTACAAAGTAAAATGTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032059162 Original CRISPR ACATAAGTATGTGCAAATAA AGG (reversed) Intronic
901589513 1:10328519-10328541 AGAAAGGTATGTACAAATAATGG + Intronic
904340670 1:29832364-29832386 ACATAAGCATATGCTAATGAGGG + Intergenic
904454941 1:30641920-30641942 ACATAAGCATATGCTAATGAGGG - Intergenic
906464662 1:46066437-46066459 ACATAAGTATTTTTATATAAAGG + Intronic
909215974 1:72889660-72889682 ACATAAGCCTATGCAAAGAAAGG - Intergenic
910038272 1:82815446-82815468 ATAGAAGTTTCTGCAAATAAAGG - Intergenic
911428336 1:97750843-97750865 ACTTGAGTATGTGCAAATTTTGG + Intronic
915201419 1:154232396-154232418 ACAAAAATATGTGTAAATCAAGG + Intronic
916115879 1:161484771-161484793 ACAGAAGTATGGGCAACTGAAGG - Intergenic
917713070 1:177707012-177707034 AATTCAGTATGTGCTAATAAAGG + Intergenic
919581455 1:199380087-199380109 ACAAAATTATGTTCAGATAATGG + Intergenic
921276616 1:213526797-213526819 ATAAAAGTATTTCCAAATAAAGG - Intergenic
921353554 1:214262735-214262757 CCACAGGTATGTGCAAAAAAGGG + Intergenic
921426207 1:215003717-215003739 ATATAAATATGTGCAAAGTAGGG - Intergenic
921666607 1:217880140-217880162 ACAGAACTATGAGCTAATAAAGG + Intergenic
923854162 1:237828178-237828200 ACAGAAGTATGTGCAGTTACTGG - Intronic
924268164 1:242303936-242303958 AAAAAAGAATTTGCAAATAATGG - Intronic
924324302 1:242880094-242880116 ACATAGGTAAATGCAAATTATGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063595004 10:7426681-7426703 ACATAAATATGCACGAATAAGGG + Intergenic
1065259142 10:23906751-23906773 TCATAGGTATGTGCACATAATGG + Intronic
1065409416 10:25407442-25407464 AAATAAATATTTGAAAATAATGG - Intronic
1065820595 10:29521512-29521534 ACATAAATTTGTACAAAAAAAGG - Intronic
1066700004 10:38117275-38117297 ACATAGGTATGAGGAGATAATGG + Intronic
1066716741 10:38294804-38294826 AAAAAAGAATTTGCAAATAATGG + Intergenic
1068884490 10:62084457-62084479 TCATAAGTCTGTTCAAATATTGG - Intronic
1069201993 10:65630856-65630878 ACACAAGTAATTGAAAATAATGG + Intergenic
1069258860 10:66368643-66368665 ACATTAATAAATGCAAATAATGG + Intronic
1069296678 10:66854467-66854489 ATATATATATGTACAAATAACGG + Intronic
1069332525 10:67310102-67310124 AAATAAGTAGGTGGAGATAAGGG + Intronic
1070471468 10:76784462-76784484 AAATAAAAATGTGCAATTAAGGG - Intergenic
1070830741 10:79416680-79416702 TCATAAATATGTGCAAAAAAAGG - Intronic
1071228736 10:83561945-83561967 AGATAAGTATTTCCAAATACCGG + Intergenic
1073795753 10:106986247-106986269 ACATATGTATGTGTATATATAGG - Intronic
1074380076 10:112972272-112972294 ACATAAGAATGGGAAAATAAAGG - Intronic
1074404274 10:113167658-113167680 AACTTAGTATGTGCAGATAAAGG + Exonic
1074686245 10:115964782-115964804 AAATGTGTGTGTGCAAATAATGG - Intergenic
1075952555 10:126494269-126494291 ACATAAGTTTGATGAAATAAAGG - Intronic
1078351176 11:10594773-10594795 ACCTGAGTATGTGCAGAGAAAGG + Intronic
1078620742 11:12905489-12905511 TCATAACTATGTTAAAATAAAGG + Intronic
1079633287 11:22704916-22704938 AATTAAGTCTGTGGAAATAAAGG - Intronic
1079836117 11:25335094-25335116 CGATAAGTATGTTAAAATAAAGG - Intergenic
1081725479 11:45324624-45324646 ATATGAGTAGGTGCAAATGAAGG - Intergenic
1085006447 11:73095551-73095573 ACATATGTATGGACATATAAGGG + Intronic
1085141556 11:74148122-74148144 ACATGAGTATTTCCAAACAAAGG - Intronic
1085490532 11:76912481-76912503 ACATAACTATCTGCCAATAAGGG + Intronic
1085695857 11:78703833-78703855 ACATAAGTAAATTAAAATAAAGG - Intronic
1086807395 11:91261584-91261606 AAATAAGTATCTCCAAAAAAGGG - Intergenic
1086925324 11:92633984-92634006 ACATGAGTATGTGCTGATCATGG + Intronic
1089217409 11:116842920-116842942 AAATAAGTATTTGGAAAGAAAGG - Intergenic
1091121038 11:133057736-133057758 ACAGAAGGATGTGCAATGAAGGG - Intronic
1093672491 12:21894167-21894189 ACAAATGTCTGTGCAAAGAAAGG + Exonic
1094110600 12:26858043-26858065 ACATAAGAAGGTGAAAAGAAAGG - Intergenic
1097990931 12:65833004-65833026 AGATAAGCATGTGCAAAATAAGG + Intronic
1098066222 12:66620178-66620200 ATATGAATATGTGCAAGTAACGG + Intronic
1098738436 12:74138091-74138113 ACATAAATAAATGCAAACAATGG - Intergenic
1099052582 12:77798795-77798817 ACATAAATATGTACCAATGAAGG + Intergenic
1099329284 12:81261985-81262007 ACATGAGTATGTGCGAACAGTGG + Exonic
1099416697 12:82396459-82396481 ACATAAGTATGAGCCACTCAAGG - Intronic
1099741095 12:86635437-86635459 ACATTAATATCTGCTAATAATGG - Intronic
1099898691 12:88681133-88681155 CTATAAGCATGAGCAAATAAAGG + Intergenic
1101178506 12:102183596-102183618 ATATAAGTATTTGCAATCAAGGG + Intronic
1101637889 12:106561239-106561261 ACATAAGTATGTGGAGAAGAAGG - Intronic
1104127572 12:125862077-125862099 ACAGCAGTTTGTGCAAACAAAGG + Intergenic
1105957314 13:25296091-25296113 GCATAAGTGTGTGCATATATGGG - Intergenic
1107297767 13:38930532-38930554 ACAAAATTATATCCAAATAATGG + Intergenic
1108006278 13:45949929-45949951 ACATAAGTAAGGAGAAATAATGG - Intergenic
1108824981 13:54402252-54402274 ACATATGAATGTACACATAAAGG - Intergenic
1109322179 13:60824592-60824614 AAAACAGTATGTGCAAATAGGGG - Intergenic
1109916559 13:68994475-68994497 ATATAATTATGTGCAAATTTAGG + Intergenic
1110743353 13:79023428-79023450 ACATGAGTATGTTCATATAATGG + Intergenic
1111104987 13:83633199-83633221 ACATAATCCTATGCAAATAATGG - Intergenic
1111342502 13:86905619-86905641 AGATAAGTATTTTCACATAAAGG - Intergenic
1112828140 13:103415935-103415957 ATATATGTATGTGTACATAAAGG + Intergenic
1113374135 13:109748423-109748445 AAATAAGCATGTTCAAAGAACGG + Intergenic
1115005570 14:28479487-28479509 ACATATCTAAGAGCAAATAAGGG + Intergenic
1115824477 14:37251640-37251662 ATATAAGTAAGTACAAAAAAGGG - Intronic
1115964060 14:38866957-38866979 ATATATGTATGTGTAAATACTGG + Intergenic
1116099983 14:40421492-40421514 ACAAAAGTATGACCAAAGAAGGG - Intergenic
1117036724 14:51738126-51738148 ACATAAATATGGGAAAAGAAGGG + Intergenic
1117171521 14:53104893-53104915 AAATATGTATGTACAAATGACGG - Intronic
1117378454 14:55136975-55136997 GCATAAGTGTGTGCAAATAGAGG + Intronic
1117593855 14:57306275-57306297 GGATAAATATGGGCAAATAATGG - Intergenic
1118118829 14:62812780-62812802 ACATAGATAAGTGTAAATAATGG - Intronic
1119068425 14:71554827-71554849 ACAAAATTCTGTGCAAAAAAAGG - Intronic
1120254673 14:82103993-82104015 ACAGAAGGATTTGAAAATAAAGG - Intergenic
1121746142 14:96294772-96294794 AGGTTACTATGTGCAAATAAGGG + Intronic
1124321536 15:28715769-28715791 AAATATGAATGAGCAAATAAAGG + Intronic
1124480968 15:30079577-30079599 AAATATGAATGAGCAAATAAAGG - Intergenic
1124885472 15:33681686-33681708 AAATAATTATGTGCATGTAAAGG - Intronic
1126275997 15:46881885-46881907 AGAAGACTATGTGCAAATAAAGG + Intergenic
1126645793 15:50873819-50873841 ACATAAATAATTGCAAGTAAAGG + Intergenic
1126719477 15:51561946-51561968 ACATAAGATTGAGAAAATAACGG - Intronic
1127637620 15:60886500-60886522 ACATAAGCAAGTGCAAGGAAAGG - Intronic
1127810143 15:62558756-62558778 AGATAAGTAACTGCAGATAACGG + Intronic
1128227421 15:66011830-66011852 AGATAATTTTGTGCAAATAAAGG + Intronic
1129651813 15:77496464-77496486 CCAAAGGTATGTGCAAACAATGG - Intergenic
1131741347 15:95396254-95396276 ATAAAAGTAAGTTCAAATAAAGG - Intergenic
1132438407 15:101833150-101833172 CCAAAAGTATGTGGAAAAAATGG - Intergenic
1134293978 16:12928551-12928573 ACATAAGGATGTGAACAAAAGGG + Intronic
1134858665 16:17541375-17541397 AGGTAAATATTTGCAAATAAAGG + Intergenic
1135341202 16:21649698-21649720 AAATAAAAATGTGTAAATAATGG - Intronic
1138159571 16:54740770-54740792 CCATGAGTATGGGCCAATAAAGG + Intergenic
1138863593 16:60789959-60789981 ACATACATATGTGAAAATATAGG - Intergenic
1138997194 16:62470423-62470445 ACATAAGTGTGTTCTTATAATGG + Intergenic
1139906863 16:70372136-70372158 ACAAAAATAGGTGCAAATGATGG + Exonic
1141043087 16:80689055-80689077 TCATTCATATGTGCAAATAAAGG - Intronic
1142739088 17:1920162-1920184 AGATAATTATCTGCAAATAATGG + Intergenic
1149304376 17:55334265-55334287 ACTTGAGTATGTGCAAATTTGGG - Intergenic
1149708344 17:58716213-58716235 ATATAAATATTTGCTAATAATGG + Intronic
1153127426 18:1811456-1811478 ACAAAATTATGTGACAATAAGGG - Intergenic
1154998508 18:21664337-21664359 ACTACAGTATGTGCAAACAAAGG - Intronic
1155526817 18:26724510-26724532 ACCTCAGTATGTTCATATAACGG - Intergenic
1156538227 18:37884274-37884296 ACATAATTAAGTGAAAATTATGG - Intergenic
1158400231 18:57115217-57115239 ACATAAGTAAATGAAAATAATGG - Intergenic
1159089165 18:63827480-63827502 AAATAAATATGTACAAATAGTGG + Intergenic
1159293495 18:66451959-66451981 AAATAATTATGTGCAAAGGATGG + Intergenic
1159778154 18:72627978-72628000 ACATAAGAAAATGCAAAGAATGG - Intronic
1160459045 18:79023648-79023670 ACATATGTATGTGTATATATAGG - Intergenic
1160524617 18:79527707-79527729 ACATTAATATGTGCAAAGATTGG + Intronic
1161765243 19:6204079-6204101 ACATAAGTATCAGCCAATACGGG + Intergenic
1166022633 19:40046368-40046390 CCATAAATATGTACAAATATTGG + Intronic
1166650188 19:44567919-44567941 GCATAATTATGTGCATATATGGG + Intergenic
927366163 2:22299209-22299231 GCATAACTATGGGCAAACAAAGG + Intergenic
931467078 2:62498945-62498967 ATATAAGTATATGAAAATCAAGG - Intergenic
931646454 2:64425959-64425981 ACATTAAAATGTGCAAAGAAAGG - Intergenic
931947596 2:67327921-67327943 ACACAAGTATTTAAAAATAAAGG - Intergenic
932996031 2:76854243-76854265 TGATAAGTATGGGCAAATGAGGG + Intronic
933012266 2:77081506-77081528 ACATATATATGTGCACATAGAGG + Intronic
933211588 2:79576059-79576081 TCATAAGTAAGTCCAAAAAAAGG - Intronic
935490011 2:103707708-103707730 ACATTATTAAGTGTAAATAATGG + Intergenic
936360902 2:111800991-111801013 AAATAAGTATATGCAAATGCAGG + Intronic
936405152 2:112196140-112196162 ACAAAAGCATGAGCAAAAAATGG + Intergenic
937766245 2:125663920-125663942 TCAGAAGTATGTGAAGATAAAGG - Intergenic
939535195 2:143418926-143418948 ACTCAAGTATGTGCAAATTGTGG + Intronic
940172580 2:150844656-150844678 CCATAAGCATCTGGAAATAAGGG + Intergenic
940572359 2:155454458-155454480 ACATAATTATTTTAAAATAAGGG + Intergenic
942339477 2:174928555-174928577 TGAAATGTATGTGCAAATAAGGG + Intronic
943202627 2:184848325-184848347 ACATAAGCATGTGGAAAAAGTGG - Intronic
943403409 2:187447492-187447514 ACAGATATATGTGTAAATAAAGG + Intronic
944112019 2:196142668-196142690 ACAGAAGTATGTGAAAATGTAGG - Intronic
944323955 2:198381473-198381495 TCATAAGTATGTACCTATAAAGG - Intronic
944979248 2:205095467-205095489 ACACAAATATGTTCAAGTAAAGG - Intronic
945089527 2:206165776-206165798 AAATAAGGATGTACTAATAATGG - Intergenic
945121925 2:206466573-206466595 ACATATGAATGAGTAAATAAGGG - Intronic
946462941 2:219886177-219886199 ACATAATAATGCACAAATAAGGG - Intergenic
947699353 2:232219427-232219449 ACAGAAGTACATGGAAATAAAGG - Intronic
1177674811 21:24283128-24283150 ACATAAGCATGGGGAAATGAAGG - Intergenic
1178151593 21:29800790-29800812 ACACAAGTATGAACAAAAAATGG + Intronic
1182650341 22:31846612-31846634 AAATGAGGATGTGCAAATAAAGG + Intronic
1182826061 22:33265790-33265812 CCATAAATATCTGGAAATAAGGG + Intronic
1183660754 22:39219676-39219698 ACTTAATTATATGCAAATTACGG - Intergenic
950020561 3:9784548-9784570 ATTTAAATATGTGCACATAAGGG - Intronic
950893252 3:16423952-16423974 AAATGATTATATGCAAATAATGG - Intronic
951096485 3:18637883-18637905 ACATATTTATGTGCAATTATAGG + Intergenic
952918317 3:38266461-38266483 ACAGAAGGATGGGCAAAAAATGG - Intronic
952998527 3:38908683-38908705 ACATAAGTATATGTAAATCCAGG - Intronic
953177020 3:40562110-40562132 ACATCAGGGTGTGGAAATAAGGG - Intronic
953511958 3:43550875-43550897 ACATAAGAAATTGCAAATAGTGG - Intronic
955515709 3:59724527-59724549 ATGTAAGTGAGTGCAAATAATGG - Intergenic
955990008 3:64616490-64616512 ACATTATTATCTGTAAATAAAGG + Intronic
956073155 3:65476121-65476143 CCATAAGTATGTGAAACTAGTGG - Intronic
957204100 3:77172444-77172466 ACATTATAAAGTGCAAATAACGG + Intronic
957970069 3:87372377-87372399 ACATAAGTAAAGGCAAATCATGG - Intergenic
959142103 3:102498624-102498646 ACATGATGGTGTGCAAATAATGG - Intergenic
959260157 3:104068336-104068358 AGATAAGTTTGTTCAAACAAGGG - Intergenic
959370905 3:105523963-105523985 ACATAAATAAATGCAAACAAAGG - Intronic
960200426 3:114828267-114828289 AAATATGTATGTGCAATAAAGGG - Intronic
960265774 3:115619438-115619460 ACATATGAATTTGCAAATAAGGG - Intergenic
962006331 3:131353542-131353564 TCACAGGTATGAGCAAATAAAGG + Intergenic
962230055 3:133656827-133656849 TCATAAATATGTACAAATGATGG - Exonic
964191380 3:154005424-154005446 ATAAAAGTATTTGCAGATAAAGG + Intergenic
965565860 3:170117059-170117081 ACATAAACATTTGGAAATAAAGG + Intronic
966509111 3:180741627-180741649 ACCTAATTATGAGCAAATCAAGG - Intronic
967598444 3:191355953-191355975 ACATACATAAGTGCAAAGAACGG + Intronic
968179065 3:196577314-196577336 ACACAAGTATTTCCAAATAATGG - Intronic
970864913 4:20747262-20747284 ACATAAGTAATTTCAAGTAATGG + Intronic
971584782 4:28391779-28391801 ACATAAGTAAGTTCAGAAAATGG + Intronic
971669013 4:29531135-29531157 ACATAAGTATTTTTAGATAATGG + Intergenic
971677027 4:29645104-29645126 GTATGAGTATGTGAAAATAATGG + Intergenic
971914849 4:32855644-32855666 GCAAAAGTATGTGCCAATAGTGG + Intergenic
971963468 4:33519655-33519677 TCATCAGCATGTGCATATAAGGG - Intergenic
974594809 4:64001208-64001230 ACATAAATACTTGCAAGTAAAGG + Intergenic
974630408 4:64480629-64480651 ACATAAGTAGGTGCAGCCAAGGG - Intergenic
974784782 4:66605418-66605440 ATATATGTATGTGCATATATAGG - Intergenic
975101388 4:70517365-70517387 CAACAAGTATGTGCAAATATAGG - Intergenic
975905871 4:79211242-79211264 ACATGAGCATGTTCTAATAAAGG + Intergenic
976035799 4:80819289-80819311 ATAAAAGTATTTGCAACTAAAGG + Intronic
976169687 4:82290256-82290278 ACATATATGTGTGCAAATATAGG - Intergenic
977875219 4:102141642-102141664 ACAAAATTATCTGAAAATAATGG + Intergenic
978649738 4:110986151-110986173 AGATAAGTATGTGGGAATATAGG - Intergenic
979247237 4:118521794-118521816 ACATCAGGATCTGCAAATAGGGG + Intergenic
979361661 4:119772877-119772899 AAATAAGAATCTGCCAATAAAGG - Intergenic
981015370 4:139968798-139968820 ACTAAAGTGTGTGCAAATGAAGG - Intronic
982623626 4:157736093-157736115 ACAAAAGTAGCTGAAAATAAGGG + Intergenic
982841951 4:160199758-160199780 TCATATGGATGAGCAAATAAAGG - Intergenic
982859047 4:160425607-160425629 ACCTAAATATTTGCAACTAATGG + Intergenic
982907470 4:161093104-161093126 ACAAAAGTATCACCAAATAATGG + Intergenic
983718881 4:170820607-170820629 ACTTAAGTATGTGCTAAGACAGG - Intergenic
983795879 4:171862228-171862250 ACATATGAATATGCTAATAATGG - Intronic
983826160 4:172263824-172263846 ACATAAGTATGTGTACATGCAGG + Intronic
987467807 5:18292980-18293002 AAAGAAGCCTGTGCAAATAAGGG + Intergenic
987502047 5:18724505-18724527 ACATATGTTTATACAAATAAAGG - Intergenic
987682171 5:21151152-21151174 ACATAAGTAATTGTAGATAATGG + Intergenic
987713568 5:21535812-21535834 AAATAATTATGTAAAAATAAAGG + Intergenic
987717965 5:21595740-21595762 ACATCTGTATGTGCAAACAAAGG - Intergenic
989225874 5:39027591-39027613 ACATAAATATGTGTAACTTATGG - Intronic
989951590 5:50305575-50305597 CCATATGTATTTGAAAATAATGG - Intergenic
990388327 5:55291029-55291051 TCATAAGTATGTGTATTTAAAGG + Intronic
991070645 5:62475876-62475898 ACATGTGTATGTCCAAATAAAGG - Intronic
993293293 5:86102400-86102422 ATATATGTATGTGAAAATCAGGG - Intergenic
993299510 5:86190017-86190039 ACATATTTATGTTGAAATAATGG + Intergenic
993805570 5:92404358-92404380 ACATAAGTATGTGCCTATTTGGG + Intergenic
994403530 5:99314545-99314567 ACATAAGTATGACAAAATGAGGG - Intergenic
994986619 5:106941586-106941608 TCAAAAGTAGGGGCAAATAAAGG - Intergenic
995590815 5:113698286-113698308 AGCTAAGTAGGTGCCAATAAAGG - Intergenic
995593087 5:113720262-113720284 ACATATGTATATGTAAATACAGG - Intergenic
995700278 5:114928307-114928329 ACATAAGTATGCAAAAGTAAAGG + Intergenic
996396633 5:123020329-123020351 ACATAAGTAAATGCAAATGGTGG - Intronic
996419513 5:123246846-123246868 ACATAAGTATGTGTAGCTTATGG + Intergenic
996555544 5:124775208-124775230 ATTTAAGTATGTCCATATAATGG + Intergenic
996844969 5:127889023-127889045 AGATACATATGTGGAAATAATGG + Intergenic
997442726 5:133919976-133919998 AAATAAGTCCCTGCAAATAAGGG + Intergenic
998709081 5:144801105-144801127 ACATGGGTATGTGAAAATTATGG - Intergenic
998732214 5:145092026-145092048 ACTTGAGTTTTTGCAAATAAAGG + Intergenic
999136975 5:149327799-149327821 ACATATGTTTGTGCACTTAATGG - Intronic
1004159340 6:13199903-13199925 ACATTAGAATGTGCAATTAAAGG - Intronic
1004620837 6:17328910-17328932 ACACAAGCAGGTGCCAATAATGG - Intergenic
1004802019 6:19159025-19159047 ACATTTGTATATGAAAATAATGG + Intergenic
1005084410 6:21990006-21990028 ACATAAATATCTGCAATCAAAGG - Intergenic
1007411968 6:41669515-41669537 ACTTAAATATGTGCAATAAATGG + Intergenic
1008391499 6:50957350-50957372 ACAGAAATATGCCCAAATAATGG - Intergenic
1009003151 6:57746087-57746109 AAATAATTATGTAAAAATAAAGG - Intergenic
1009825692 6:68863153-68863175 CTATATGTATGTGTAAATAAAGG + Intronic
1011605257 6:89097760-89097782 AAGTAGGTATGTGGAAATAATGG + Exonic
1011827478 6:91327036-91327058 ACATCAGTGTATGCAAAGAATGG + Intergenic
1012339054 6:98096321-98096343 GTATTAGTATGTGCAATTAAAGG + Intergenic
1013481885 6:110559973-110559995 ACATAATAATGTGTAATTAAAGG - Intergenic
1014501369 6:122194032-122194054 GCATATCTATGAGCAAATAAAGG - Intergenic
1014575590 6:123066860-123066882 GTATGAGTATGTTCAAATAAAGG - Exonic
1014969489 6:127796561-127796583 ACATAACTTTTTGGAAATAATGG + Intronic
1015603009 6:134928757-134928779 ACATAAAGATCAGCAAATAAGGG - Intronic
1016133621 6:140509215-140509237 GTATACTTATGTGCAAATAAGGG + Intergenic
1021274243 7:18629685-18629707 ACAGAAGTATGTGTCAATCAAGG + Intronic
1022722039 7:32950141-32950163 ACATAAACAGGTGGAAATAAAGG - Intergenic
1024154661 7:46608889-46608911 ACATAACTCTCTCCAAATAATGG + Intergenic
1024435951 7:49354777-49354799 ATTTAATTATGTGCAAATTAAGG + Intergenic
1024480698 7:49859074-49859096 AAATAAGTATGTGCCCATATGGG - Intronic
1024973169 7:55089056-55089078 ACAAATATATGTACAAATAAAGG + Intronic
1025060624 7:55803407-55803429 AGATAAGTATTTACAAAAAAAGG + Intronic
1028097686 7:86782605-86782627 ACATAAGCCTGTAAAAATAAGGG - Intronic
1028278698 7:88893302-88893324 AGATAAGTATGTCCCAAAAATGG - Intronic
1029962837 7:104706868-104706890 AGATAAGAATGTGCAAAGAATGG - Intronic
1031009859 7:116514566-116514588 CCATCAGTATGTTCAAACAAGGG + Intergenic
1032059162 7:128709327-128709349 ACATAAGTATGTGCAAATAAAGG - Intronic
1033541751 7:142362906-142362928 TCAGAAGCATGTGCCAATAATGG + Intergenic
1034800905 7:154055195-154055217 AGATATATATGTGCAGATAATGG - Intronic
1035610667 8:961704-961726 ACATAACTATGTGAAAATTATGG + Intergenic
1036110598 8:5896703-5896725 ATACAAATATGTTCAAATAATGG + Intergenic
1037943419 8:22971900-22971922 AGATAGGGATGTGTAAATAATGG - Intronic
1040410280 8:47147151-47147173 ACATAAATGTGTACAAATAGAGG - Intergenic
1043156612 8:76789413-76789435 AAATAAATATGTGCATATCACGG + Intronic
1043593689 8:81859627-81859649 ACATAAGCATGTGAAGAAAAGGG + Intergenic
1043676838 8:82967260-82967282 ACATATGTATGTGTATATATAGG + Intergenic
1043875028 8:85476088-85476110 ACATATGGATGTCCAAATGATGG - Intronic
1044506603 8:93027359-93027381 ATATAAGCGTGTGCAAATAATGG + Intergenic
1045886760 8:107107852-107107874 TCTTAAGTATGTGCAAAGAAAGG - Intergenic
1046304675 8:112349619-112349641 ACTTACATATGTGCAGATAATGG - Intronic
1049227279 8:141461538-141461560 AGTTAATTATGTGCAAATTACGG - Intergenic
1050122662 9:2323571-2323593 ACATAAATATTTGCACATATGGG + Intergenic
1052127741 9:24798740-24798762 ACACAAGAAAGTGCAAAAAAAGG - Intergenic
1053343099 9:37355649-37355671 ACATAAGTAAGTGCAGATTTTGG - Intronic
1053531763 9:38889278-38889300 ATATAGATATGTGCTAATAATGG - Intergenic
1054203986 9:62113706-62113728 ATATAGATATGTGCTAATAATGG - Intergenic
1054634376 9:67474659-67474681 ATATAGATATGTGCTAATAATGG + Intergenic
1058241104 9:102561204-102561226 AGATAGGTAAGTGCAAAAAATGG - Intergenic
1059660547 9:116395875-116395897 ACATAAGTCTCTGCACATACTGG - Intronic
1060210143 9:121705218-121705240 ACATATGCTTGTGCAAAGAAAGG - Intronic
1186149271 X:6656843-6656865 CAATATGTATGTGCAAATAGAGG - Intergenic
1186173176 X:6898977-6898999 ATTTAAGTAGGTGCAAATGAAGG - Intergenic
1186911885 X:14176082-14176104 ACATAATTATGTAAAAATAAAGG - Intergenic
1187206697 X:17188380-17188402 AGATAAGCATGTGAAAATAAGGG - Intergenic
1188827928 X:34859489-34859511 ACAAAAGTAGCTGCAAATGAAGG - Intergenic
1189606120 X:42679939-42679961 AGATGAGCATGTGCAAAGAATGG - Intergenic
1189646579 X:43139245-43139267 AACTAAGTATGTACAAAAAAAGG - Intergenic
1189675666 X:43458180-43458202 ACTTCAGTTTGTGCAAACAACGG + Intergenic
1189768714 X:44399961-44399983 AAGTAACTATGTGCAAAGAATGG + Intergenic
1190008506 X:46761580-46761602 ACATAAATATGTAGAGATAATGG - Intergenic
1190960338 X:55240750-55240772 ACATAAGTATTTGCAAACTCTGG + Intronic
1192086994 X:68109885-68109907 ACACAAGTATCTGAAAATAGGGG - Intronic
1193853106 X:86563921-86563943 ACATAAAAATGTGGAAATAAGGG - Intronic
1194413294 X:93580447-93580469 GCATAAGAACTTGCAAATAAAGG + Intergenic
1194926031 X:99824991-99825013 GCATAGTTATGTGCAAACAATGG - Intergenic
1198261634 X:134970066-134970088 ACATATTTATGTACAACTAATGG - Intergenic
1198666388 X:139028270-139028292 AAATAAGTTTGTGAAAACAATGG + Intronic
1199022249 X:142895129-142895151 TGATAAGTAAGTCCAAATAAAGG - Intergenic
1201595417 Y:15662858-15662880 ACATAGGTATATGCACGTAATGG + Intergenic
1201616868 Y:15910117-15910139 TCATAAGTAGGTGCTAAAAATGG - Intergenic
1201616877 Y:15910305-15910327 ACATAAATATTTACAAATATAGG - Intergenic
1202070435 Y:20986381-20986403 ACATAATTATGAACAAATAATGG - Intergenic
1202172143 Y:22061142-22061164 ACATAAATATTTAAAAATAATGG + Intergenic
1202219219 Y:22525229-22525251 ACATAAATATTTAAAAATAATGG - Intergenic
1202323962 Y:23670836-23670858 ACATAAATATTTAAAAATAATGG + Intergenic
1202546809 Y:25999218-25999240 ACATAAATATTTAAAAATAATGG - Intergenic