ID: 1032059774

View in Genome Browser
Species Human (GRCh38)
Location 7:128714942-128714964
Sequence CAGGTTATGGAAGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032059774_1032059777 -9 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059777 7:128714956-128714978 CATAACCTGCAGATCCACCAGGG No data
1032059774_1032059788 29 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059788 7:128714994-128715016 TGCTGCAAAGCTTAGGAAGATGG 0: 1
1: 0
2: 0
3: 24
4: 175
1032059774_1032059780 -2 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059780 7:128714963-128714985 TGCAGATCCACCAGGGTGTCGGG 0: 1
1: 0
2: 1
3: 16
4: 129
1032059774_1032059779 -3 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059779 7:128714962-128714984 CTGCAGATCCACCAGGGTGTCGG No data
1032059774_1032059776 -10 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059776 7:128714955-128714977 CCATAACCTGCAGATCCACCAGG No data
1032059774_1032059789 30 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059789 7:128714995-128715017 GCTGCAAAGCTTAGGAAGATGGG No data
1032059774_1032059781 -1 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059781 7:128714964-128714986 GCAGATCCACCAGGGTGTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1032059774_1032059782 0 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059782 7:128714965-128714987 CAGATCCACCAGGGTGTCGGGGG No data
1032059774_1032059785 22 Left 1032059774 7:128714942-128714964 CCTGCAACTGCTTCCATAACCTG 0: 1
1: 0
2: 1
3: 21
4: 179
Right 1032059785 7:128714987-128715009 GCCCACATGCTGCAAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032059774 Original CRISPR CAGGTTATGGAAGCAGTTGC AGG (reversed) Intronic
901199529 1:7458664-7458686 CAGGTTATGAAGTCAGGTGCCGG - Intronic
901501424 1:9654733-9654755 CACGTTAAGGAAACATTTGCTGG - Intronic
903242355 1:21991817-21991839 CAGGTTATAGAAGGAGCTGTGGG + Intronic
903245867 1:22015004-22015026 CAGGTTATAGAAGGAGCTGTGGG + Intergenic
905693046 1:39956462-39956484 CAGGTTGTGGCAGCTGGTGCCGG + Intronic
907250065 1:53132182-53132204 CATGTCATGGAAGCTGTTGAAGG + Intronic
907788442 1:57636744-57636766 AAGGTTATGGAAGGAATAGCTGG + Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908437636 1:64121964-64121986 CAGGTTGTGGCAGCTGGTGCAGG - Intronic
908671221 1:66549793-66549815 CAGGTTATCTGAGCAGTTTCTGG + Intronic
909137677 1:71821929-71821951 CTGGTTGTGGGAGGAGTTGCTGG - Intronic
910563504 1:88618288-88618310 CAGCTTGTGAAAGCAGTTGTGGG - Intergenic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
911962136 1:104318913-104318935 CAGGTTCTGGATGAAGTTGGTGG + Intergenic
915234200 1:154468658-154468680 CAGGTTGTGGAATCTGTTGCTGG + Exonic
919689344 1:200515359-200515381 GAGGTTGTGTGAGCAGTTGCAGG - Intergenic
920569080 1:207002781-207002803 CAGGTTATGTAAGCAGAGGCTGG + Intergenic
1063100829 10:2948668-2948690 CAGATCATGGAAGCAATTGTGGG - Intergenic
1064493650 10:15885614-15885636 CAGGTTATGGAAGCAGGATTGGG + Intergenic
1068949663 10:62764483-62764505 GGGGTTAAGAAAGCAGTTGCTGG - Intergenic
1068976407 10:63015239-63015261 CAGGTTTGGTAAGCAGGTGCAGG - Intergenic
1070005045 10:72415682-72415704 TAAGTTATGGAAGCAGATGGTGG - Intronic
1072377823 10:94836262-94836284 CAGGTAGTGGCAGCAGTAGCAGG - Intronic
1072464293 10:95648941-95648963 CAGGTTTTGGAACCAGTTCCTGG - Intronic
1072741098 10:97910355-97910377 CAGGTCTGAGAAGCAGTTGCAGG + Intronic
1075859473 10:125662216-125662238 CAGGCTATGGAAACATTTCCAGG - Intronic
1076549807 10:131271140-131271162 CAGGTTCTGGAGGCAGGTTCTGG - Intronic
1076549810 10:131271153-131271175 CAGGTTCTGGAGGCAGGTTCTGG - Intronic
1079707336 11:23637410-23637432 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1080990510 11:37529113-37529135 CAGATCATGGAATCAGCTGCAGG - Intergenic
1081909624 11:46692524-46692546 CTGGTTAGGGAAGCTGTTGGGGG + Intronic
1082631376 11:55546083-55546105 CTGGGTATGGCAGCACTTGCTGG - Intergenic
1082926422 11:58552062-58552084 AAGGTGATGGAAGCCATTGCAGG + Intronic
1083327691 11:61881505-61881527 CAGCTTATAGAACCAGTAGCTGG + Intronic
1085837477 11:79972347-79972369 CAGGATATGGGAGCACTTGGAGG - Intergenic
1088366642 11:109046922-109046944 CTGGATATGGTAGCAGGTGCTGG - Intergenic
1088388769 11:109290476-109290498 CAGCCTGTGAAAGCAGTTGCAGG - Intergenic
1089220113 11:116863648-116863670 CAGGTAATGGAAGAGGTGGCAGG - Exonic
1090606243 11:128425341-128425363 AAGGTTATGAAAGCAGGTTCTGG + Intergenic
1093350963 12:18102959-18102981 CAGCCTGTGAAAGCAGTTGCAGG - Intronic
1096624670 12:52887138-52887160 GAGTTGATGGAAGCAGTTTCAGG - Intergenic
1096684316 12:53277705-53277727 GAGGTTGTGGAAGCAGTGGGAGG + Intronic
1097298648 12:57994935-57994957 CAGGAATTGGAAGCAGTGGCTGG - Intergenic
1104451009 12:128868160-128868182 CAGGAGAGGGAAGCAGATGCAGG - Intronic
1106661660 13:31806439-31806461 GAGGTCATGTAAGCAGTTGATGG - Intergenic
1112023840 13:95394670-95394692 CAGGTTATGGGAGCAGGAGAAGG + Intergenic
1112673203 13:101665907-101665929 AAGGTTAGGCAGGCAGTTGCTGG - Intronic
1114634463 14:24179509-24179531 CAGGTGGTGGAAACAGCTGCTGG + Intronic
1115939383 14:38591482-38591504 CAGGGAATTGAAGCAGGTGCTGG - Intergenic
1117566909 14:57002685-57002707 AAGGTTTTGGAAGGAGTTGGTGG + Intergenic
1117758284 14:58999040-58999062 CAGGCCATGAAAACAGTTGCAGG + Intergenic
1118074212 14:62280828-62280850 CAGTATATGGAAGCATTTGCAGG + Intergenic
1118338863 14:64878961-64878983 CAGGCTGGGGAAGCAGCTGCGGG - Intronic
1118392499 14:65307207-65307229 CAGGTGATAGAATCACTTGCAGG + Intergenic
1119383985 14:74245826-74245848 CAGGTCAGGGCAGCAGTTGCTGG - Intronic
1119433467 14:74583324-74583346 CAGGTTTCTCAAGCAGTTGCTGG - Intronic
1122765441 14:104066331-104066353 CAGGCTGTGAAAGCAGCTGCAGG - Intergenic
1131701117 15:94936095-94936117 CAAGTTAGGGAAGCAATTGTTGG + Intergenic
1133189204 16:4121048-4121070 CTGGTTATGGAGGCACCTGCAGG - Intergenic
1134805242 16:17118683-17118705 CAGGATATAGAAGAAATTGCAGG - Intronic
1135835954 16:25825451-25825473 CAGGACATGCAAGCAGTTGAGGG + Intronic
1139472893 16:67187645-67187667 CAGGCTGTGGAAGCAGCTGCAGG - Exonic
1140750016 16:78014869-78014891 CAGGTTCAGGAAGCACTTCCTGG + Intergenic
1142306486 16:89288803-89288825 CAGTTTAGGGAAGCAGGTGCTGG + Intronic
1146364832 17:32214652-32214674 CAGGTTTTGGCAGCTGTTACTGG + Intronic
1147260018 17:39204407-39204429 CAGCTTCTGGAATGAGTTGCTGG - Intronic
1149257236 17:54840506-54840528 CAGGTAAAAGAAACAGTTGCAGG + Intergenic
1150953436 17:69827651-69827673 GAGGTTAGGGAGGCAGTTGCTGG + Intergenic
1151798153 17:76360537-76360559 CAGGTTGTACAGGCAGTTGCTGG + Intronic
1152251171 17:79213417-79213439 TAGGTCCTGGTAGCAGTTGCGGG - Intronic
1154402224 18:14051141-14051163 CAGGTCATGGTAGTAGCTGCTGG + Intergenic
1154419223 18:14209893-14209915 CAGGGTATGGTAGCATGTGCAGG - Intergenic
1155846186 18:30709760-30709782 CATGTAATGAAAGCAGTTGCTGG - Intergenic
1159269211 18:66127444-66127466 GAGAATATGGAAGCAGTGGCTGG + Intergenic
1161961852 19:7527692-7527714 CACCTTAGGGAAGTAGTTGCTGG - Intronic
1163998706 19:21077262-21077284 CAGCTTGTGAAAGCAGCTGCAGG + Intergenic
1164036571 19:21460917-21460939 CAGCTTGTGAAAGCAGCTGCAGG - Intronic
1166879179 19:45916736-45916758 CAGGATATGGAAACTGTGGCTGG + Intergenic
1166916511 19:46199122-46199144 CAGGGTAGGGCAGCAGTTGGAGG + Intergenic
1167385961 19:49163826-49163848 CAGGTGTTGGAAGTAGCTGCAGG + Intronic
925008096 2:461127-461149 CAGGCTGCGCAAGCAGTTGCTGG - Intergenic
926459123 2:13106546-13106568 AAGGTTAGGCAAGCAGTTGCCGG - Intergenic
926602917 2:14865320-14865342 CAGGTTGGGGAAGCAGGTGGGGG + Intergenic
932721337 2:74140937-74140959 GTGGTTAAGGAAGCAGTTTCTGG - Intronic
932766644 2:74474747-74474769 CAGGCTATTGAGGCAGCTGCTGG + Exonic
933510972 2:83241260-83241282 GAGGTTATAAAAGCAGTTGGTGG - Intergenic
934498024 2:94827434-94827456 CAGGGTATGGTAGCACATGCAGG + Intergenic
934561310 2:95314944-95314966 CTGGTTCTGGCAGCCGTTGCGGG - Intronic
936161845 2:110089344-110089366 CAGTTTGTGAAAGCAGCTGCAGG + Intronic
936182818 2:110282010-110282032 CAGTTTGTGAAAGCAGCTGCAGG - Intergenic
937260784 2:120585841-120585863 CAGGTAATGGGAGCAGTGGCTGG + Intergenic
937532304 2:122844160-122844182 CAGGTCAGGGAAGCTTTTGCTGG + Intergenic
939065547 2:137479481-137479503 CAGGTTGGAGCAGCAGTTGCTGG + Intronic
940094235 2:149956079-149956101 CTGGTTAGGGAAGCAATGGCTGG - Intergenic
940649957 2:156432546-156432568 CAGCATATGGATGCAGCTGCAGG - Intergenic
942180025 2:173371289-173371311 CAGGTGATGTAAGCATTTGAGGG + Intergenic
947276556 2:228398086-228398108 CATGTCATGGAAGGTGTTGCAGG - Intergenic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947811634 2:233008258-233008280 AAGGGTATGGAGGCAGTTGTGGG + Intronic
948341951 2:237260578-237260600 CATGTTATGGTACCAGTGGCAGG - Intergenic
948740587 2:240043466-240043488 CAGGATTTGGATGCAGTGGCCGG - Intergenic
1170651309 20:18245194-18245216 CAGGTGATGGAGGCAGTTTTGGG + Intergenic
1173132240 20:40405171-40405193 CAGATTATGGAAGAATTTGTAGG - Intergenic
1176854083 21:13949400-13949422 CAGGGTATGGTAGCACGTGCAGG + Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1177402397 21:20623153-20623175 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1178927827 21:36790815-36790837 CAGGTTCTGGGAGCAGCTGATGG + Intronic
1180822737 22:18842609-18842631 CATGTTATGGAATCAGATGGTGG + Intergenic
1180994902 22:19960684-19960706 CAGGTGATGGAACCCGGTGCAGG - Intronic
1181190226 22:21133417-21133439 CATGTTATGGAATCAGATGGTGG - Intergenic
1181208976 22:21277107-21277129 CATGTTATGGAATCAGATGGTGG + Intergenic
1181502926 22:23329091-23329113 CATGTTATGGAATCAGATGGTGG - Intergenic
1181653730 22:24277466-24277488 CATGTTATGGAATCAGATGGTGG - Intronic
1184378148 22:44128102-44128124 AAGATTCTGGAAGCAGCTGCCGG + Intronic
1185044187 22:48520759-48520781 GAGGACATGGAAGCAGTTTCTGG - Intronic
1185329091 22:50243900-50243922 CAGGTTATGGAGGCTGCTCCAGG - Exonic
1203217963 22_KI270731v1_random:18341-18363 CATGTTATGGAATCAGATGGTGG - Intergenic
1203272874 22_KI270734v1_random:68516-68538 CATGTTATGGAATCAGATGGTGG + Intergenic
949692333 3:6654659-6654681 CAGCTTATGAAAGCAGCTGCAGG - Intergenic
950136483 3:10584632-10584654 CAGCTTCTGCAAGCAGTGGCTGG - Intronic
950851000 3:16062296-16062318 CAGGTTCTGGCACCAGCTGCTGG + Intergenic
953245326 3:41185689-41185711 CAGGTAATGCAAGCAGAGGCTGG + Intergenic
953918592 3:46936601-46936623 CAAGCTTTGGAAGCAGTTCCCGG - Intronic
954977606 3:54711449-54711471 CAGGTGATGGCAGCAGTTTGAGG + Intronic
958034741 3:88156336-88156358 CTGGTTATGGTTGGAGTTGCTGG + Exonic
959314502 3:104785718-104785740 CAGGTCATGGAAGCAGAGACTGG + Intergenic
960406890 3:117272194-117272216 GAGATTATGGAATCAGTAGCAGG - Intergenic
961117711 3:124345988-124346010 CAGATTTTGGAAGCACTTACTGG - Intronic
964132371 3:153303737-153303759 CAAATTATGGAAGCAGTGACTGG + Intergenic
965095462 3:164219397-164219419 CAGATGATGCAATCAGTTGCTGG - Intergenic
965169952 3:165250240-165250262 GAGGTTAGAGAAGCAGTTGCTGG + Intergenic
966742783 3:183249684-183249706 CAGGCCATAGAAGCAGTAGCAGG + Intronic
967539468 3:190648600-190648622 CAGGTTCTGGAAGCAGCTGCAGG + Intronic
968466154 4:752492-752514 CAGGCTCTGGAAGCAGCAGCTGG - Intronic
968630253 4:1646926-1646948 CAGAGTGTGGAAGCAGCTGCTGG - Intronic
969588251 4:8106980-8107002 CAGGTTAAGGCAGCAGTGGTTGG - Intronic
971722352 4:30261889-30261911 CAGGTTTTGGAAATAGTTGGTGG + Intergenic
980418507 4:132526001-132526023 GAGGTTATAGAGGCAATTGCTGG + Intergenic
980800272 4:137739012-137739034 CAGATAATTGAAGCAGTTGTGGG - Intergenic
981115743 4:140989057-140989079 CAGTTTGTGGTAGCATTTGCTGG - Intronic
982432465 4:155338384-155338406 CAGCTCATGGAAGCAGCTGCAGG + Intergenic
983343858 4:166502094-166502116 TAGGTGATGCAAGCAGTGGCAGG + Intergenic
985047657 4:185956524-185956546 CTGGTTAGGGAATCAGTGGCAGG + Exonic
990866438 5:60385603-60385625 CAGGTCATGGAATGACTTGCAGG - Intronic
990979509 5:61589812-61589834 CTGTTTATGGAAGCAGTGGCAGG + Intergenic
991422945 5:66460002-66460024 CAGTTCATGGAAGGAGTTGAGGG - Intergenic
991609153 5:68433041-68433063 CAGATCCTGGAAGAAGTTGCAGG - Intergenic
994337203 5:98581272-98581294 CAGGATATGGAAACAAATGCTGG + Intergenic
995716710 5:115087767-115087789 AAGGTTATGGAAGCATTAACGGG - Intergenic
997091522 5:130864294-130864316 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
997566970 5:134895449-134895471 CAGGTTAGGGAGGGAGTTGCGGG - Intronic
997658543 5:135573166-135573188 CAGGTTATGGAAGAGGCTGAGGG - Intronic
1000257700 5:159556420-159556442 CAGATTCTGGAGGCAGTGGCTGG + Intergenic
1001035948 5:168296332-168296354 CAAGTCATGGGAGAAGTTGCTGG - Intronic
1003147541 6:3521315-3521337 CAGGGTCTGGAATCAGTTGGCGG + Intergenic
1003454706 6:6271050-6271072 CAGGTTATGGAAGCGTTATCAGG + Intronic
1008139172 6:47812096-47812118 CGGGTTAGGGAGGCAGTTTCTGG + Intronic
1009545073 6:65010244-65010266 CAGGTAGTGGCAGCAGTAGCAGG + Intronic
1010860130 6:80900074-80900096 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1010980725 6:82365614-82365636 CAGGTAAAGGAAGTGGTTGCTGG - Exonic
1011415487 6:87115548-87115570 GAGGTTGAGCAAGCAGTTGCTGG - Intergenic
1015350705 6:132215075-132215097 CAGATAATGGGAGCAGATGCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG + Intergenic
1017696292 6:157019766-157019788 CAGGTCATGGCACAAGTTGCAGG - Intronic
1020768877 7:12361885-12361907 GAGGTGATGGAAGCTTTTGCAGG - Intronic
1021554754 7:21908071-21908093 CAGGCTCTGGCAGCAGTTGCTGG - Intronic
1023604705 7:41918976-41918998 CAGGTTATGAAAGAGGTGGCTGG + Intergenic
1023733624 7:43216006-43216028 CAGTTTATGGAAGTAGTCTCTGG + Intronic
1027919184 7:84370179-84370201 CAGGCAAAGGAAGCAATTGCTGG + Intronic
1029273825 7:99392780-99392802 CAGGTTCTGGAAGCGCTCGCGGG - Exonic
1032059774 7:128714942-128714964 CAGGTTATGGAAGCAGTTGCAGG - Intronic
1032400811 7:131623143-131623165 AAGGTTCTGGAAGCAGTTTTGGG + Intergenic
1036601507 8:10265084-10265106 CAGGATATTGAATCAGCTGCAGG - Intronic
1038689051 8:29744525-29744547 CAGGTTAGGGAAGGAGCTGCTGG - Intergenic
1043127977 8:76424828-76424850 AAGGTGATGGACGCAGATGCAGG - Intergenic
1043711998 8:83431994-83432016 CAGGTTTTGGAAGCAAATGTGGG + Intergenic
1045355899 8:101388859-101388881 CAGGGTATTGAAGCAGAGGCTGG + Intergenic
1045872762 8:106945213-106945235 CTGTTTATGGAGACAGTTGCTGG + Intergenic
1048418603 8:134254005-134254027 CAAGTCATGAAAGCAGCTGCTGG - Intergenic
1050643441 9:7693387-7693409 CAGCTTGTGAAAGCAGCTGCAGG + Intergenic
1050947677 9:11546993-11547015 CTGAAAATGGAAGCAGTTGCTGG - Intergenic
1051197972 9:14584586-14584608 CAGGATAGGGCAGCAGTTACGGG + Intergenic
1053538433 9:38948845-38948867 CTGTTTATGGGGGCAGTTGCAGG + Intergenic
1053659129 9:40253088-40253110 CAGGGTATGGTAGCACATGCAGG - Intronic
1053909499 9:42882454-42882476 CAGGGTATGGTAGCACATGCAGG - Intergenic
1054371253 9:64399386-64399408 CAGGGTATGGTAGCACATGCAGG - Intronic
1054525470 9:66123134-66123156 CAGGGTATGGTAGCACATGCAGG + Intronic
1054627705 9:67415074-67415096 CTGTTTATGGGGGCAGTTGCAGG - Intergenic
1054678879 9:67889107-67889129 CAGGGTATGGTAGCACATGCAGG - Intronic
1057139380 9:92717489-92717511 GAGGTCACGCAAGCAGTTGCTGG - Intronic
1058748197 9:108012693-108012715 CAGGTTAAGGAAGCAGATTTAGG - Intergenic
1059566832 9:115390924-115390946 CAGATTATGGAAGGCCTTGCAGG + Intronic
1060019617 9:120117795-120117817 CAGCCTTTGGAAGCAGTAGCAGG + Intergenic
1185813290 X:3130317-3130339 CAGGTTATGAAATCAGTTCCAGG - Intergenic
1186902677 X:14074762-14074784 CAGGTTAAGAAAGTATTTGCTGG + Intergenic
1188842542 X:35034296-35034318 AAGGTTTTGGAAGCAGATGGTGG + Intergenic
1192317853 X:70066278-70066300 CAGGTTAGGGAAGAACTGGCTGG + Intergenic
1194864392 X:99048339-99048361 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1197595058 X:128454627-128454649 CAGCCTGTGAAAGCAGTTGCAGG - Intergenic
1199034404 X:143033282-143033304 CAGGATATGGAAGCAGGCTCAGG + Intronic
1201268309 Y:12230209-12230231 CAGGTTATGAAATCAGTTCCAGG + Intergenic