ID: 1032064471

View in Genome Browser
Species Human (GRCh38)
Location 7:128755575-128755597
Sequence CCTGCTTTGCAAGTGCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032064469_1032064471 10 Left 1032064469 7:128755542-128755564 CCATTTGTTTTCTCTGGCACATG 0: 1
1: 0
2: 0
3: 27
4: 389
Right 1032064471 7:128755575-128755597 CCTGCTTTGCAAGTGCTTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 178
1032064468_1032064471 11 Left 1032064468 7:128755541-128755563 CCCATTTGTTTTCTCTGGCACAT 0: 1
1: 0
2: 1
3: 31
4: 343
Right 1032064471 7:128755575-128755597 CCTGCTTTGCAAGTGCTTTAAGG 0: 1
1: 0
2: 1
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032064471 Original CRISPR CCTGCTTTGCAAGTGCTTTA AGG Intronic
900512220 1:3066211-3066233 CCTGCCTGGCAAGGGCTTTGGGG - Intergenic
903303658 1:22397008-22397030 CCTCCTTGGGAAGTGCTTTAGGG - Intergenic
903871770 1:26440650-26440672 GCTGCCTTGCAAGGTCTTTAGGG + Intronic
906799756 1:48726224-48726246 CCTGCTTTACAAGTGCTTTTAGG - Intronic
908409797 1:63851925-63851947 CCTGCTGTGCCACTGCTTTTAGG - Intronic
911006668 1:93233211-93233233 ACTGCTTTGCCATTTCTTTAAGG - Intronic
911284280 1:95971347-95971369 TTTGATTTGCCAGTGCTTTATGG + Intergenic
913042815 1:115044583-115044605 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
913583536 1:120250480-120250502 CATGCTTGACAAGTGCTTTTAGG - Intergenic
913624640 1:120647840-120647862 CATGCTTGACAAGTGCTTTTAGG + Intergenic
914565524 1:148862316-148862338 CATGCTTGACAAGTGCTTTTAGG - Intronic
916556567 1:165898995-165899017 CATGCTTGGCATGTGCTTTGTGG + Intronic
919451428 1:197776189-197776211 CCTGCTTCACATGTGCTTTAGGG - Intergenic
919807326 1:201387884-201387906 CCTGCTCTCCATGTGCTTTCAGG + Intronic
919973968 1:202599046-202599068 CCTCCTTCCCAAGTGCTTCAGGG - Intronic
922487656 1:225988097-225988119 CCTGCTTTCCATGTGCTCTTTGG + Exonic
1063307989 10:4923803-4923825 ACTGCCTTTCAAATGCTTTAAGG - Intronic
1063320254 10:5045685-5045707 CCTGCTTTGCAGGTCTTTCAGGG + Intronic
1064316597 10:14263348-14263370 GCAGCCTTGCAAGTGATTTATGG - Intronic
1064861868 10:19835406-19835428 CATGTTTTCCAGGTGCTTTAGGG + Intronic
1068125177 10:52830971-52830993 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
1069369959 10:67737430-67737452 CCTGCTTTTCTAGTTCTTTGGGG - Intergenic
1070743193 10:78916072-78916094 CCTGCTTCCAAAGTGCTTTGGGG - Intergenic
1070851655 10:79568012-79568034 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
1071833536 10:89395748-89395770 CCTGCCTTGAAAGAGCTTCAGGG - Intronic
1071848997 10:89549643-89549665 ACTGCTTGCCAATTGCTTTAGGG + Intronic
1072664061 10:97381266-97381288 CCTGCAGTGGCAGTGCTTTACGG - Intronic
1075279460 10:121127294-121127316 CTTGCTTTGCAAGTGCTGCAGGG + Intergenic
1076408879 10:130231804-130231826 CCTGCTTTGCTAGTTGTTTGGGG + Intergenic
1076701902 10:132277603-132277625 CTTGCTTTGCAACTGCCTTTGGG + Intronic
1079194798 11:18315996-18316018 CCTGTTATCCCAGTGCTTTAGGG + Intronic
1079312738 11:19380825-19380847 CCTGCTTTGCCTGGGATTTAGGG + Intronic
1079702271 11:23563415-23563437 CCTGCTTTTCTAGTTCTTAAAGG + Intergenic
1080064856 11:27999785-27999807 CTTTCTTGGCAAGTCCTTTAGGG + Intergenic
1085199980 11:74696107-74696129 CTTGCTGGGAAAGTGCTTTAAGG + Intergenic
1086206074 11:84259452-84259474 CCTGCTTTGCCCCTGCTCTACGG + Intronic
1086256758 11:84886081-84886103 CCTTCTTTGAAACTCCTTTAAGG - Intronic
1087694137 11:101356281-101356303 CTTGCTTTCCTAGTTCTTTAGGG - Intergenic
1089781720 11:120877850-120877872 CCTGCTTTGTGAGTGCTCTGGGG + Intronic
1089845735 11:121456567-121456589 CCTGATTTGCCTGTGCTATATGG + Intronic
1092808928 12:12253797-12253819 GCTGATTTGCAAGTGCTTTCAGG - Intronic
1094326439 12:29244819-29244841 TCTGCTGTACAAGTTCTTTAAGG - Intronic
1094662533 12:32484330-32484352 CCTACTCTCAAAGTGCTTTAAGG + Intronic
1100198917 12:92277884-92277906 ACTGCTTTGCAAATGCTTAAAGG - Intergenic
1101583698 12:106066564-106066586 CCTGTTTGGCATTTGCTTTATGG - Exonic
1103946092 12:124527380-124527402 CCTACTTTACAAGAGCTTTTAGG + Intronic
1104271060 12:127282618-127282640 CTTGCTGTGCCAGTGCTTGAGGG + Intergenic
1109244897 13:59941633-59941655 CTTGCTTTGTAAGTGGTTAATGG + Intronic
1111714235 13:91859205-91859227 CATGCTTTTCTAGTTCTTTAAGG + Intronic
1113010678 13:105762187-105762209 GCTGCTTTGCAGGTGCTCTTTGG - Intergenic
1114188018 14:20418183-20418205 CCTTATTTGCAAGTTCTTAAAGG + Intergenic
1114236245 14:20826601-20826623 CCTGATTTGTAAGTACTTTAAGG + Intergenic
1117080835 14:52150564-52150586 CCTGCCATACAAGTGCTTTCTGG + Intergenic
1117606630 14:57436352-57436374 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
1117685820 14:58251988-58252010 CCTGGTTTTCAAATGTTTTAAGG + Intronic
1118057068 14:62089988-62090010 CCTGCTATCCAACTGCTTCATGG + Intronic
1118827915 14:69400571-69400593 CCTCCTTTGAAAGTACTTTCAGG - Intronic
1120006501 14:79363763-79363785 TGTGCTTTTCAATTGCTTTAGGG + Intronic
1120340423 14:83213853-83213875 CTTGCTTTTCTAGTTCTTTATGG + Intergenic
1120420265 14:84276505-84276527 CCTACTTTGTATTTGCTTTAAGG + Intergenic
1120439741 14:84520986-84521008 ACTGCTTTTCAAGTGTTTTTAGG + Intergenic
1120464562 14:84840018-84840040 CTAGTTTTGCAAATGCTTTATGG - Intergenic
1125113177 15:36057759-36057781 CCTGCTCTACAAGTATTTTAAGG - Intergenic
1125328341 15:38559748-38559770 CGTCCTTTAAAAGTGCTTTACGG - Intronic
1128211427 15:65905847-65905869 CCTGCTTAGCAAATGCTTGTGGG - Intronic
1130263415 15:82377445-82377467 TTGGTTTTGCAAGTGCTTTAAGG + Intergenic
1130277889 15:82492221-82492243 TTGGTTTTGCAAGTGCTTTAAGG - Intergenic
1130470217 15:84219406-84219428 TTGGTTTTGCAAGTGCTTTAAGG - Intergenic
1130477705 15:84333973-84333995 TTGGTTTTGCAAGTGCTTTAAGG - Intergenic
1130494060 15:84454157-84454179 TTGGTTTTGCAAGTGCTTTAAGG + Intergenic
1130592506 15:85224034-85224056 TTGGTTTTGCAAGTGCTTTAAGG - Intergenic
1131210871 15:90495232-90495254 CTTGCTTTGCACGTGGTTCATGG + Intronic
1134226455 16:12394866-12394888 CCTGCTGTGGAAGAGCTTTGTGG + Intronic
1135471949 16:22739083-22739105 CATGCTTTACAAATCCTTTACGG - Intergenic
1138423820 16:56917018-56917040 GCTGCTTTGCATGTGCCTGAAGG - Intergenic
1140119238 16:72069130-72069152 CTGGTTTTGCAAGTGCTTTAAGG - Intronic
1141190761 16:81823072-81823094 CCTGCTTTATAAGTGCCCTACGG - Intronic
1141890762 16:86925159-86925181 CCTGCTTTTTAACAGCTTTAGGG - Intergenic
1143713431 17:8749826-8749848 CCTCATTTGCATGTGGTTTATGG + Intergenic
1145785710 17:27592605-27592627 CCTTCTTTGTCAGTGCTTTGGGG - Exonic
1146140715 17:30365608-30365630 CCTGCTTTGCTAGTGCCTTCAGG - Intergenic
1147357941 17:39912186-39912208 CCTGCTTTTCATGAGCTTTGTGG - Intronic
1149246805 17:54718444-54718466 CCTGCTTTCCAAGAGCTTACTGG - Intergenic
1149561148 17:57608801-57608823 CTTGCTTTGCAAGTTCCTTGAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153673887 18:7438593-7438615 CGTGCTTTGCCAGTGCTGTTGGG - Intergenic
1155282543 18:24254763-24254785 CTTGCTTTTCTAGTTCTTTAAGG - Intronic
1156623381 18:38880090-38880112 CATGCTTAGTAAATGCTTTATGG + Intergenic
1157473949 18:48009592-48009614 CCTGCTCTGCAAGATCCTTACGG - Intergenic
1157782597 18:50453435-50453457 CCAGCTTTGCAAATGCCCTAGGG - Intergenic
1161328615 19:3675704-3675726 CCTGGTTTGCATGGGCTTTGGGG - Intronic
1162004161 19:7766568-7766590 CCTGATTTTCAAGGGCTTGAAGG + Intronic
1162047495 19:8010357-8010379 CCTTCATGGCAAATGCTTTATGG + Intronic
1164729249 19:30489942-30489964 CCTGATTTGCAAGTTCTCAAAGG + Intronic
1164934021 19:32197277-32197299 CCTGGTTTGCCAGGGCTTTCTGG - Intergenic
925673639 2:6337703-6337725 CCTACTCTGCCAGTGCCTTAAGG - Intergenic
925823335 2:7822455-7822477 CCCGCTTTGCAAGGGATTTGGGG - Intergenic
928630906 2:33190873-33190895 CCAGTTTTGCAAATGCTTTTGGG + Intronic
932474760 2:71996137-71996159 CCTGCTATCCAAGTGGATTATGG + Intergenic
933083875 2:78029980-78030002 CTTGCTTTGCAAGTTTTATAAGG - Intergenic
934084964 2:88502295-88502317 CCTGCATTGCAAGTGCCTCTTGG + Intergenic
939800702 2:146703892-146703914 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
941584192 2:167336314-167336336 CATGCTTGGCAAGTCTTTTATGG + Intergenic
942210745 2:173667146-173667168 TCAGCTTTGCCAGTGCTTAAGGG + Intergenic
943055261 2:182969723-182969745 CTTGCTTTTCTAGTTCTTTAAGG - Intronic
946320679 2:218952571-218952593 TCTGCTTTTCAAGGGCTTTGAGG - Intergenic
947805101 2:232961056-232961078 GCTGCTTTGCAAGTCCTCTTTGG - Intronic
1169956727 20:11111286-11111308 CCTCCTTTCAAAGTGCTTTCAGG + Intergenic
1171067438 20:22032021-22032043 CCTTGTTTGCAAATTCTTTAGGG - Intergenic
1171993121 20:31712002-31712024 CCTACTTTGCAAGATTTTTAAGG + Intronic
1172797715 20:37553698-37553720 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
1177964370 21:27709163-27709185 CTTGCTTTCCTAGTTCTTTAGGG + Intergenic
1179367099 21:40768711-40768733 CCTGATGTGGAAGTGCTTCAAGG + Intronic
1180851021 22:19020660-19020682 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
1180880397 22:19199326-19199348 TCTGTTTTTCAAGTGCCTTAGGG - Intronic
1181447590 22:22989967-22989989 CCTGCTTTGCAAGAGCAGTATGG - Intergenic
1184219245 22:43088714-43088736 CCTGCTTTGCAAATGCCAAAAGG + Intronic
953485358 3:43289390-43289412 CTTCCTTTTCAAATGCTTTAAGG - Intronic
954360817 3:50121913-50121935 CCTGCCTTGCAAGTTCCTGAGGG + Intergenic
957622244 3:82608466-82608488 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
959938901 3:112059867-112059889 CCTGTTTCCCGAGTGCTTTAGGG + Intronic
964757585 3:160102611-160102633 CTTGCTGTGCAAGTTCTTTAAGG - Intergenic
965637595 3:170799989-170800011 CCTAATTTGCCAGTGTTTTATGG - Intronic
967903803 3:194485288-194485310 CCTGGTTTGCAACCCCTTTAAGG - Intronic
970622660 4:17840377-17840399 TCTGCTTTTCAAGTGTTTTTTGG + Intronic
974771946 4:66426502-66426524 CTTGCTTTTCTAGTTCTTTAAGG - Intergenic
975366524 4:73535723-73535745 CCAGGTTTCCAAATGCTTTAAGG + Intergenic
975730934 4:77336552-77336574 CTTGTTCTGCAAGTGCCTTAAGG + Intronic
977596234 4:98884274-98884296 CCTACTTTGAAAGTGCTGTTTGG - Intronic
980265593 4:130511356-130511378 TCTGATTTGCAAGCACTTTAAGG - Intergenic
981120614 4:141046864-141046886 CCTTCTTTGCAAGTACATTTTGG + Intronic
982277211 4:153648342-153648364 CCAGCTTTCCCAGTGCTTTGAGG - Intergenic
982826996 4:160014493-160014515 TCTGATTTCCAAGTGCATTAGGG - Intergenic
983356991 4:166675236-166675258 TCTGGTTTGCAAGTAGTTTAAGG - Intergenic
983775466 4:171601288-171601310 CCTGCTTAGGATGTGCATTAAGG + Intergenic
985690253 5:1305540-1305562 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
988236638 5:28554087-28554109 CTTGCTTTACTAGTTCTTTAAGG + Intergenic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
992815984 5:80438864-80438886 CCTTCTTTGCAAGTGTTTTCAGG - Exonic
993086710 5:83371946-83371968 CTTACTTTGCTAGTGCTTTCTGG - Intergenic
993683294 5:90906785-90906807 TCTGCTTTTCTAGTTCTTTAAGG + Intronic
994772423 5:103999905-103999927 GCTGCTTTGCAAATTCTTTTGGG - Intergenic
996410647 5:123155377-123155399 TCTGTTTTGCCAGTTCTTTACGG + Intronic
998676733 5:144417703-144417725 GCTTTTTTGCAAGTGTTTTATGG + Intronic
999850662 5:155534932-155534954 AGTGCTTCACAAGTGCTTTATGG + Intergenic
1000216098 5:159158062-159158084 CATACTTTGTATGTGCTTTAGGG - Intronic
1000944727 5:167407109-167407131 CCTGCTTTGCCCTTGCTTTTGGG + Intronic
1003231029 6:4253962-4253984 CCAGCTTTGCAAGTGAGTTAGGG - Intergenic
1005320989 6:24653510-24653532 TCTGCTTTGCAAATGACTTATGG - Intronic
1008938832 6:57022690-57022712 CCTGCTTTTCTAGTTCTTTGAGG + Intronic
1010158409 6:72822549-72822571 CATGCTTTCCTAGTGCTTTCGGG + Intronic
1010943364 6:81946482-81946504 CCTGAATTGGAAGTGCTTTAAGG - Intergenic
1012504061 6:99924462-99924484 CTTGCTTTTCTAGTTCTTTAAGG + Intronic
1012679674 6:102164121-102164143 AATGCTTTGAAAGTTCTTTAAGG - Intergenic
1012969375 6:105711220-105711242 CCTGCATTGCTAGTACTTTGAGG - Intergenic
1013395394 6:109732299-109732321 CATGCTTTGCAAATGCTTTGAGG - Intronic
1025222431 7:57125720-57125742 ACTGCTTTGCCATTGCTTTTGGG - Intronic
1025266506 7:57463443-57463465 ACTGCTTTGCCATTGCTTTTGGG + Intronic
1025633216 7:63297394-63297416 ACTGCTTTGCCATTGCTTTTGGG - Intergenic
1025649480 7:63450795-63450817 ACTGCTTTGCCATTGCTTTTGGG + Intergenic
1025719208 7:63994277-63994299 ACTGCTTTGCCATTGCTTTTGGG + Intergenic
1027986585 7:85299292-85299314 TCAGCTTTGCAATTGATTTATGG + Intergenic
1028287348 7:89019040-89019062 CTTGCTTTTCTAGTTCTTTAGGG + Intronic
1028424039 7:90666125-90666147 CTTGGTTTCCAAGTGCTTCATGG + Intronic
1032064471 7:128755575-128755597 CCTGCTTTGCAAGTGCTTTAAGG + Intronic
1032880030 7:136079052-136079074 CCTGCTTTCCAAATGCTTTTAGG + Intergenic
1034291286 7:149934043-149934065 CATGCATTGCTAGTGCTGTAAGG - Intergenic
1034348079 7:150399114-150399136 CCTGCTTTGGAAGGGCGTGAGGG - Intronic
1034778615 7:153855738-153855760 CCTGCTTAGGAAGTGCCTCAAGG + Intergenic
1034814813 7:154162892-154162914 CATGCATTGCTAGTGCTGTAAGG + Intronic
1035841364 8:2814625-2814647 CAGGCTTTGCAGGTGCTTAATGG - Intergenic
1038946597 8:32368264-32368286 CCTGCTTTGAAAGTACTTCTAGG + Intronic
1042465048 8:69119748-69119770 CCTTCTTTCCTAGTGCTCTAAGG + Intergenic
1043638766 8:82422086-82422108 CCTGCTTTTCTAGTTCTTTGAGG + Intergenic
1043945676 8:86249197-86249219 CTTGCTTTTCTAGTTCTTTAAGG + Intronic
1044354324 8:91203301-91203323 CCTGTTGTTCAAGTGATTTAGGG + Intronic
1048127947 8:131658168-131658190 GCTGTTTTGCCTGTGCTTTAGGG + Intergenic
1049313244 8:141944988-141945010 CCTGCTGTGCAAGTACTTGTGGG + Intergenic
1050392549 9:5160531-5160553 CTTGCTTTTCTAGTTCTTTAAGG - Intronic
1051162017 9:14219589-14219611 CCTGCTTTACACGTATTTTATGG + Intronic
1055298264 9:74856026-74856048 CCTTATTTGATAGTGCTTTATGG - Intronic
1055777639 9:79783090-79783112 ACTGCTTTGCAAGAGCTATTAGG + Intergenic
1057172368 9:92970612-92970634 CCTGCATAGCAAGTGGTTTCAGG + Intronic
1057760541 9:97870397-97870419 CCTGATTTGCAATTGCTTTCTGG - Intergenic
1059900314 9:118917867-118917889 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
1059977332 9:119731456-119731478 ACTGCTTTGCTAGTGCTTCCTGG + Intergenic
1061277982 9:129580419-129580441 CCTGCTTTGTAAATGATTAAAGG - Intergenic
1061582603 9:131546654-131546676 CCCGCTGGGCAAGTGCTTGAGGG - Intergenic
1061787089 9:133035966-133035988 TTGGTTTTGCAAGTGCTTTAAGG + Intronic
1186034938 X:5411842-5411864 CCTGCTTTGCAAGTTATTATCGG - Intergenic
1186746023 X:12570212-12570234 CCTGCATTGCCAGTGCCTCAGGG + Intronic
1188939704 X:36222063-36222085 CCTTCTTTCCCTGTGCTTTAGGG + Intergenic
1189251908 X:39606846-39606868 CCTCAATTGCAACTGCTTTATGG + Intergenic
1196532294 X:116802853-116802875 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
1197542717 X:127785945-127785967 CTTGCTTTTCTAGTTCTTTAAGG + Intergenic
1200740634 Y:6850115-6850137 ACTGCTTTGCAATTGCATGAGGG - Intergenic