ID: 1032067633

View in Genome Browser
Species Human (GRCh38)
Location 7:128783510-128783532
Sequence CAGAAAAAGTAGGGCTCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067633_1032067639 24 Left 1032067633 7:128783510-128783532 CCGGACGAGCCCTACTTTTTCTG No data
Right 1032067639 7:128783557-128783579 ATACACTGCCTGCCCCTTCTAGG No data
1032067633_1032067640 28 Left 1032067633 7:128783510-128783532 CCGGACGAGCCCTACTTTTTCTG No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067633 Original CRISPR CAGAAAAAGTAGGGCTCGTC CGG (reversed) Intergenic
No off target data available for this crispr