ID: 1032067634

View in Genome Browser
Species Human (GRCh38)
Location 7:128783519-128783541
Sequence GAGAAGGGACAGAAAAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067634_1032067640 19 Left 1032067634 7:128783519-128783541 CCCTACTTTTTCTGTCCCTTCTC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067634_1032067639 15 Left 1032067634 7:128783519-128783541 CCCTACTTTTTCTGTCCCTTCTC No data
Right 1032067639 7:128783557-128783579 ATACACTGCCTGCCCCTTCTAGG No data
1032067634_1032067645 30 Left 1032067634 7:128783519-128783541 CCCTACTTTTTCTGTCCCTTCTC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067634 Original CRISPR GAGAAGGGACAGAAAAAGTA GGG (reversed) Intergenic
No off target data available for this crispr