ID: 1032067636

View in Genome Browser
Species Human (GRCh38)
Location 7:128783534-128783556
Sequence GTGTACGTGGCAGCAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067636_1032067639 0 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067639 7:128783557-128783579 ATACACTGCCTGCCCCTTCTAGG No data
1032067636_1032067645 15 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067636_1032067646 26 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067636_1032067640 4 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067636 Original CRISPR GTGTACGTGGCAGCAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr