ID: 1032067637

View in Genome Browser
Species Human (GRCh38)
Location 7:128783535-128783557
Sequence TGTGTACGTGGCAGCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067637_1032067645 14 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067637_1032067639 -1 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067639 7:128783557-128783579 ATACACTGCCTGCCCCTTCTAGG No data
1032067637_1032067646 25 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067637_1032067640 3 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067637 Original CRISPR TGTGTACGTGGCAGCAGAGA AGG (reversed) Intergenic
No off target data available for this crispr