ID: 1032067638

View in Genome Browser
Species Human (GRCh38)
Location 7:128783547-128783569
Sequence GCAGGCAGTGTATGTGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067638_1032067647 20 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067647 7:128783590-128783612 AAAGGTAGCCTCATGGTGTGTGG No data
1032067638_1032067640 -9 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067638_1032067648 27 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067648 7:128783597-128783619 GCCTCATGGTGTGTGGCTAAAGG No data
1032067638_1032067645 2 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067638_1032067646 13 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067638 Original CRISPR GCAGGCAGTGTATGTGTACG TGG (reversed) Intergenic
No off target data available for this crispr