ID: 1032067640

View in Genome Browser
Species Human (GRCh38)
Location 7:128783561-128783583
Sequence ACTGCCTGCCCCTTCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067634_1032067640 19 Left 1032067634 7:128783519-128783541 CCCTACTTTTTCTGTCCCTTCTC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067638_1032067640 -9 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067635_1032067640 18 Left 1032067635 7:128783520-128783542 CCTACTTTTTCTGTCCCTTCTCT No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067632_1032067640 29 Left 1032067632 7:128783509-128783531 CCCGGACGAGCCCTACTTTTTCT No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067633_1032067640 28 Left 1032067633 7:128783510-128783532 CCGGACGAGCCCTACTTTTTCTG No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067636_1032067640 4 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data
1032067637_1032067640 3 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067640 7:128783561-128783583 ACTGCCTGCCCCTTCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067640 Original CRISPR ACTGCCTGCCCCTTCTAGGA TGG Intergenic
No off target data available for this crispr