ID: 1032067645

View in Genome Browser
Species Human (GRCh38)
Location 7:128783572-128783594
Sequence CTTCTAGGATGGAAGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067635_1032067645 29 Left 1032067635 7:128783520-128783542 CCTACTTTTTCTGTCCCTTCTCT No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067638_1032067645 2 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067637_1032067645 14 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067634_1032067645 30 Left 1032067634 7:128783519-128783541 CCCTACTTTTTCTGTCCCTTCTC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data
1032067636_1032067645 15 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067645 7:128783572-128783594 CTTCTAGGATGGAAGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067645 Original CRISPR CTTCTAGGATGGAAGCAAAA AGG Intergenic
No off target data available for this crispr