ID: 1032067646

View in Genome Browser
Species Human (GRCh38)
Location 7:128783583-128783605
Sequence GAAGCAAAAAGGTAGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032067641_1032067646 -5 Left 1032067641 7:128783565-128783587 CCTGCCCCTTCTAGGATGGAAGC No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067636_1032067646 26 Left 1032067636 7:128783534-128783556 CCCTTCTCTGCTGCCACGTACAC No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067638_1032067646 13 Left 1032067638 7:128783547-128783569 CCACGTACACATACACTGCCTGC No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067637_1032067646 25 Left 1032067637 7:128783535-128783557 CCTTCTCTGCTGCCACGTACACA No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067643_1032067646 -10 Left 1032067643 7:128783570-128783592 CCCTTCTAGGATGGAAGCAAAAA No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data
1032067642_1032067646 -9 Left 1032067642 7:128783569-128783591 CCCCTTCTAGGATGGAAGCAAAA No data
Right 1032067646 7:128783583-128783605 GAAGCAAAAAGGTAGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032067646 Original CRISPR GAAGCAAAAAGGTAGCCTCA TGG Intergenic
No off target data available for this crispr