ID: 1032068821

View in Genome Browser
Species Human (GRCh38)
Location 7:128791605-128791627
Sequence CTGGGGGTCTGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 0, 2: 9, 3: 118, 4: 927}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032068821_1032068832 -4 Left 1032068821 7:128791605-128791627 CCCTCCTCCTTCCAGACCCCCAG 0: 1
1: 0
2: 9
3: 118
4: 927
Right 1032068832 7:128791624-128791646 CCAGGTGCTCCCGGCCTCCGCGG 0: 1
1: 0
2: 2
3: 19
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032068821 Original CRISPR CTGGGGGTCTGGAAGGAGGA GGG (reversed) Intronic
900483777 1:2911829-2911851 CTCAGGGTCTGAGAGGAGGAAGG + Intergenic
900649613 1:3724366-3724388 CTGGGGGTCTGGTACAGGGATGG - Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900999515 1:6141796-6141818 CCAGGAGGCTGGAAGGAGGAAGG + Intronic
901209483 1:7516378-7516400 ATTGGGGGCTGGGAGGAGGAGGG + Intronic
901808484 1:11752353-11752375 CTGGGGGTCTGGGACGATGAGGG - Intronic
901883421 1:12207089-12207111 GTGGGGGCCTGGAAGGACCAGGG - Exonic
902265187 1:15258231-15258253 CTGGGGGGCTGGGAGGGGAAGGG - Intronic
902677061 1:18016112-18016134 CTGGTGGTCTGGAAGGGGAGAGG + Intergenic
902802977 1:18841845-18841867 ATAGGGATCTGGAGGGAGGAGGG + Exonic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903539059 1:24086607-24086629 CCGGGGGTCGGGGAGGAGGCAGG - Intronic
903588629 1:24437592-24437614 CAGGAGGTCTGGAACCAGGATGG + Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903858449 1:26351068-26351090 AAGGGGGACTGGAAGGTGGAGGG + Intronic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904790770 1:33018993-33019015 CTGGGGGGCAGGAAGGTAGAAGG - Intronic
904832912 1:33316726-33316748 CTGGTTGTCTGGTTGGAGGAAGG + Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905151341 1:35930709-35930731 CGGGGGCTCAGGAAGGAGGGTGG + Intronic
905346561 1:37315106-37315128 CTTGGGGACTGGAATGAGGCAGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905450167 1:38051064-38051086 GTGGGGGGCTGGGAGTAGGAGGG + Intergenic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
906144178 1:43550265-43550287 CCGGCGGCCTGGAAGGAGGAGGG - Intronic
906290524 1:44616922-44616944 GTGGGGGTGTGGAAAAAGGAAGG - Intronic
906677238 1:47701960-47701982 CTGGGGGTCAGGGAGGAGGTTGG - Intergenic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
906937978 1:50230962-50230984 CTTGGAGTCTAGCAGGAGGAGGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907321084 1:53602721-53602743 TTGGGGGTCTGTAAGAAGCAGGG + Intronic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
907786843 1:57620791-57620813 CTCTGGGTCTGGAAGCAGGGGGG + Intronic
907902170 1:58750930-58750952 CTTGGAGTCTGGAAGAAGCAAGG + Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909430097 1:75577474-75577496 CTGGATGTCTGGAAGAAGAAAGG - Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
910771921 1:90839569-90839591 GTGGGTGTGTGGGAGGAGGAGGG + Intergenic
911288779 1:96029231-96029253 CTTGGGGGCTGGGAGCAGGAAGG - Intergenic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912458352 1:109814757-109814779 CAGATGGTCTGCAAGGAGGAGGG - Intergenic
912773756 1:112490270-112490292 CTGGGGGACTTGGAAGAGGAGGG + Intronic
912808854 1:112778313-112778335 CAGAGGGTGTGGAAGGAGTAAGG - Intergenic
912863894 1:113239614-113239636 CTGGGCGGCTTGAAGGAGCAAGG - Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913353489 1:117890173-117890195 CTGGTGGTGGGGAAGGAGGTGGG + Intronic
913530774 1:119732814-119732836 CCTGGGGGCTGGCAGGAGGAAGG - Intronic
913966274 1:143380079-143380101 GTGGGGGTCAGTAAGAAGGAGGG + Intergenic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914060648 1:144205686-144205708 GTGGGGGTCAGTAAGAAGGAGGG + Intergenic
914118502 1:144760683-144760705 GTGGGGGTCAGTAAGAAGGAGGG - Intergenic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917735434 1:177915798-177915820 GTGGGGGTGAGGCAGGAGGAGGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
919901461 1:202046918-202046940 TTGGGTTTCTGGAAGGAGCAAGG + Intergenic
919982598 1:202651458-202651480 CTGGGGTTCAGAAAGGAGGTTGG + Intronic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920073535 1:203320862-203320884 GTGGGGGACTGAGAGGAGGATGG + Intergenic
920251034 1:204622607-204622629 ATGGGGGTCAGGAAGCAGGGAGG + Intronic
920331518 1:205211586-205211608 CTGGGGGGCGGGGAGGAGGGAGG - Intergenic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921163499 1:212489345-212489367 GTGGGAGTCTGGAAGAATGAGGG - Intergenic
921185375 1:212665531-212665553 CAGGGGGCGAGGAAGGAGGAGGG - Intergenic
921935101 1:220788390-220788412 CTGGGGAGCTGGTAGGAGAAAGG - Intronic
922155616 1:223038124-223038146 CTGGAGGCCTGGGAGGAGGGAGG - Intergenic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922852285 1:228743360-228743382 CTGACGTTCTGGAAGGATGAGGG - Exonic
923031788 1:230255048-230255070 ATCAGGTTCTGGAAGGAGGAAGG + Intronic
923090358 1:230735821-230735843 TTGGGGGGCTGGAAGCAGCAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924188698 1:241524435-241524457 CTAGGGGTTTGAAAGGAGAAAGG - Intergenic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1062911977 10:1217229-1217251 CTGGGCGTTTGGCACGAGGAAGG + Intronic
1063455845 10:6182313-6182335 CTGGGGGTCTGGGTGCAGGAGGG + Intronic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1065971776 10:30811409-30811431 CTGAGGGTCTGGAAGGGGAGGGG - Intergenic
1066242368 10:33550819-33550841 AGGAGGGGCTGGAAGGAGGAAGG - Intergenic
1066387784 10:34955431-34955453 GGGGGAGTCTGGAAGGAGGCTGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067216908 10:44310932-44310954 CTGGGGGACTGCATGGAGAAGGG + Intergenic
1067497437 10:46773505-46773527 CCGGGGGTCAGGCAGGAGGGGGG - Intergenic
1067497486 10:46773653-46773675 CTGGGGCTCTGGCAGGAGTTGGG + Intergenic
1067597166 10:47566762-47566784 CTGGGGCTCTGGCAGGAGTTGGG - Intergenic
1067597215 10:47566910-47566932 CCGGGGGTCAGGCAGGAGGGGGG + Intergenic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1068875732 10:61994607-61994629 CTGGGGGTGGGGAAGGAGTCGGG - Intronic
1068880872 10:62047645-62047667 CAGGGTGGCTGGAAGGAGGTGGG + Intronic
1068959115 10:62848888-62848910 AAGAGAGTCTGGAAGGAGGATGG + Intronic
1069532411 10:69229177-69229199 CTGGGGCTCTCGCAGGAGCAGGG + Intronic
1069740057 10:70681761-70681783 CTGGGTGTCTGGGAGGGGGTAGG - Intronic
1069754417 10:70764361-70764383 GTAGGGGTCTGGGGGGAGGAGGG + Intergenic
1069776090 10:70928098-70928120 CTGGGGGTTTAGAGAGAGGAGGG + Intergenic
1069802583 10:71091242-71091264 CTGAGGGTGAGGAAGGAGGGTGG + Intergenic
1069835240 10:71304050-71304072 CTGGGGGTCTGCATGCAGGTGGG - Intergenic
1070140517 10:73734373-73734395 CTGGGGCTCTGGCAGGAGTTGGG - Intergenic
1070456984 10:76626972-76626994 CTGGCTGCCTGGAAGGAGGTGGG + Intergenic
1070513174 10:77179447-77179469 CTGGAGGTGGGCAAGGAGGAGGG + Intronic
1070545883 10:77452131-77452153 CCTGGCCTCTGGAAGGAGGAAGG + Intronic
1070682991 10:78462187-78462209 ATGGGCCTCTGGCAGGAGGAGGG + Intergenic
1070789416 10:79180584-79180606 CTGGGGGACTCGGAGGAGGAAGG - Intronic
1070806725 10:79275109-79275131 CTAGGGGCCTGGGAGAAGGATGG + Intronic
1070922923 10:80199988-80200010 CTTGCTGTCTGGAATGAGGAAGG + Intronic
1071110167 10:82146684-82146706 GTTGGGGTATGGAAGGAGGTGGG + Intronic
1071284124 10:84128661-84128683 CTGGGGTTGTAGAAAGAGGAAGG - Intergenic
1071527047 10:86365066-86365088 CTGGGGGCTGGGTAGGAGGAGGG + Intronic
1072038618 10:91586837-91586859 CTGGTGGTCTGCCAGGAGAATGG + Intergenic
1072447918 10:95515598-95515620 CTGGGGGGCAGGAAGGAGTGTGG + Intronic
1073026140 10:100488606-100488628 CAGGGGTACTGGAAGGAGGGTGG - Intronic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073442421 10:103560257-103560279 CTGGGGGGCTGGAAGGACTGGGG + Intronic
1073464095 10:103683847-103683869 CTTGGGATCTGCAAGGTGGAAGG - Intronic
1074094371 10:110296788-110296810 CTTGGGGCCTGGAAGGTGGGTGG - Intronic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074638294 10:115346266-115346288 CTTAGGGTCTGGAAGGAGGTGGG - Intronic
1074986491 10:118664379-118664401 CTGGGGTTCTGGGGGTAGGATGG + Intergenic
1075395619 10:122124955-122124977 CTGGGGGGCTGGGAGGGGGCGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076829209 10:132985825-132985847 CTGGGGGTCGGGGAGGAGACAGG + Intergenic
1077025410 11:437839-437861 CTGGGGTTCTGGGCAGAGGAGGG - Intronic
1077152088 11:1077067-1077089 CAGGGGGCCTGGAAGGGGGCTGG + Intergenic
1077224801 11:1435250-1435272 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224813 11:1435279-1435301 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224825 11:1435308-1435330 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224837 11:1435337-1435359 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224849 11:1435366-1435388 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224861 11:1435395-1435417 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224873 11:1435424-1435446 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224885 11:1435453-1435475 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224897 11:1435482-1435504 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224909 11:1435511-1435533 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224921 11:1435540-1435562 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224933 11:1435569-1435591 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077249756 11:1555737-1555759 CTGGGGCTCTGGCAGGAGTTGGG + Exonic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077672522 11:4168648-4168670 ATGGGGGCCAGGAAGGAGAAGGG - Intergenic
1078104575 11:8350647-8350669 GTGGGGGTCAGGAAGGGGAAAGG + Intergenic
1078156632 11:8805556-8805578 CTGAAGGACTGGAAGTAGGAGGG - Intronic
1078528359 11:12117884-12117906 CTGAGGGTCTGGAAAGAGGTTGG - Intronic
1078781235 11:14441275-14441297 CTGGGGGCCTGGAAGTGGTAAGG - Intergenic
1078953829 11:16167143-16167165 GTGAGGGTCTGGAAGTTGGAGGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081687803 11:45054891-45054913 GGGAGGCTCTGGAAGGAGGAGGG - Intergenic
1082833824 11:57638391-57638413 CAGGGAGTGTGGAAGGAGAAAGG + Intergenic
1083243162 11:61404577-61404599 CTGGGTGTCTGGAGGGAGTTAGG + Exonic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083593249 11:63907314-63907336 CAGGGGGTCTGGAGAGAGCAGGG + Intronic
1083660438 11:64249533-64249555 CTGGGGCCCTGGAAGGGGTAGGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084069238 11:66723366-66723388 CTCGGGTTCTGGAAGGAAGGAGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084296503 11:68215936-68215958 CTGGGGGCCTGGGAGCAGGCTGG - Intergenic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1084448036 11:69215453-69215475 CTTGGGGGCTGGGAGGTGGAAGG - Intergenic
1084562803 11:69913878-69913900 CTGTGGGGCCGTAAGGAGGAGGG - Intergenic
1084593710 11:70105058-70105080 CGGGGGTCCTGGAAGGAGGGCGG - Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085328643 11:75628272-75628294 CTGGGGGTGAGGAAGGAGTATGG + Intronic
1085350956 11:75797634-75797656 CAGGAGGTCAGGAAGGAGGGTGG + Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085462418 11:76702127-76702149 CTGGGGGTGTTCACGGAGGATGG - Intergenic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087943993 11:104135999-104136021 ATTGGAGTCTGGAAGGAGAAAGG + Intronic
1088319038 11:108535840-108535862 CTGGGGGTCTGGAACAAGAAAGG + Intronic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1088919484 11:114250940-114250962 CTGGGGGTCTTGGTGGAGGAAGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089016067 11:115166460-115166482 ATGGGGCTGGGGAAGGAGGAGGG + Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089303483 11:117512602-117512624 CTGAGGGTGGGGAAGGGGGAAGG + Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089515520 11:119029476-119029498 CTGGGAGGCTGGGTGGAGGAGGG - Exonic
1089595848 11:119579632-119579654 CTGGGGGGCTAGAAGCAAGAGGG - Intergenic
1090044022 11:123315344-123315366 CTGAGGGGCTGAAAGGAGGGAGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090277954 11:125432679-125432701 AAGGGGGTCTGGAAGGTGGGTGG - Exonic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090442679 11:126737251-126737273 CTGGGGCTCAGGAAGGGGGCAGG + Intronic
1090765351 11:129871575-129871597 GTAGGGGTCTGAGAGGAGGAAGG - Intronic
1090935909 11:131342078-131342100 GAGGGGGTGTGGAAGGAGCAGGG + Intergenic
1091089145 11:132753177-132753199 CTGGGAGCCAGGAAGGAGTATGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091696000 12:2628506-2628528 CTAGGTGTGTGAAAGGAGGAAGG - Intronic
1091754969 12:3045366-3045388 CTGGGTGTCAGGAAAGGGGAGGG + Intergenic
1091780819 12:3213626-3213648 AAGGGGGGCTGGAAGGGGGAGGG - Intronic
1091823016 12:3490773-3490795 GTGGGTGTCTGGATGGGGGAGGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092245083 12:6859593-6859615 CAGGCGGTCAGGGAGGAGGAAGG - Intronic
1092879316 12:12875706-12875728 CTGGGGGCCTGGAGGGGGTAGGG - Intergenic
1093077080 12:14769836-14769858 CTGGGGGTCTAGAAGGGAAACGG - Intronic
1093575946 12:20730007-20730029 CTGGGGGTCTGGGAGGTCAATGG + Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1095603106 12:44037193-44037215 CTTGGGGGCTGGAAGCAGGCAGG + Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096262817 12:50103671-50103693 CTGGGGGACAGAAAGGAGCAAGG + Intergenic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096468888 12:51864191-51864213 CCGGGGGTCTGGGAGGCGGGAGG - Intergenic
1096531949 12:52248090-52248112 CTTGGGGCCTGGAAGGAGAGAGG + Intronic
1096710457 12:53452092-53452114 CTGCTGGTCTGGGAGGGGGACGG - Intronic
1097106741 12:56630247-56630269 CCGGGGTTCGGGAAGGGGGAGGG + Intronic
1097167103 12:57091706-57091728 CTGGGGGGCTGGCAGCAGGTGGG + Exonic
1097180276 12:57167850-57167872 ATGGGGGTTTGCAAGGAGAAAGG - Intronic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098515735 12:71374617-71374639 CTGGGACTCTGGGAGCAGGATGG - Intronic
1098808006 12:75045230-75045252 CTGGGGGTCTTGTAGGAGCAAGG - Intronic
1098901807 12:76118772-76118794 CTGGGGGTCCCAAAGGTGGATGG + Intergenic
1099654327 12:85469487-85469509 ATGGGGGTCGGGCTGGAGGATGG + Intergenic
1100049000 12:90421633-90421655 GTGGTGGTGTGGAAGGTGGAAGG + Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1103027724 12:117587392-117587414 CTGCTGGTTTTGAAGGAGGAGGG + Intronic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104595332 12:130116718-130116740 CTGGGGGTCTGGGAGTTTGACGG + Intergenic
1104595954 12:130120121-130120143 CTGGGGGTCTGCACGGTGCAGGG - Intergenic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104849273 12:131863510-131863532 CTGGGGGCCTGGGAGGTGAAGGG + Intergenic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG + Intergenic
1107846959 13:44524905-44524927 CTGTGCTTCTGGAAGGAGAAAGG + Intronic
1107980169 13:45727600-45727622 CTGTGCTTCTGGCAGGAGGAGGG - Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108002269 13:45915226-45915248 CTTGGGGGCTGGAAGCAGGCAGG + Intergenic
1108082073 13:46747082-46747104 CAGGGGGTCTGAAAAGAGGCAGG + Intronic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108626721 13:52236227-52236249 GTGGGGGTGTGGGAGGAAGATGG - Intergenic
1108659347 13:52570258-52570280 GTGGGGGTGTGGGAGGAAGATGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111520666 13:89399046-89399068 CTGGGGGTTAGGGATGAGGAAGG - Intergenic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1112697661 13:101968903-101968925 CTGGGGGTTTGGAAGCAGGGAGG + Intronic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113614673 13:111671701-111671723 ATGGGGGTTTGGCAGGAGGAGGG + Intronic
1113620142 13:111756615-111756637 ATGGGGGTTTGGCAGGAGGAGGG + Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1114532815 14:23405988-23406010 CTGGGGATCTGGCAAGAGAAAGG - Intronic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1118355787 14:65012507-65012529 CTGTGGCTCTGGCAGGAGGTAGG + Intronic
1118407562 14:65441939-65441961 GTGGGGTTGTGGGAGGAGGAGGG - Intronic
1118777203 14:68980122-68980144 CGGGGTGTCTGTGAGGAGGAGGG - Intergenic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119412141 14:74439295-74439317 TTGAGGGTCTGGGAGGAGGCTGG + Intergenic
1119422177 14:74513909-74513931 CTGGGGCTCTGGTCTGAGGAAGG - Intronic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120546077 14:85813057-85813079 CTTTGGGACTGGAAGGAGTAAGG + Intergenic
1120750737 14:88195692-88195714 CTGGGGTTTTGGAAGTAGGATGG - Intronic
1121018253 14:90561819-90561841 CTGGGGCTGTGGAAACAGGAGGG + Intronic
1121458130 14:94052199-94052221 TTGGTGGTGTGGAAGGAGCATGG + Intronic
1121600527 14:95199851-95199873 CTGGGGGTGTGGGAGGATGCTGG + Intronic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1121746532 14:96299296-96299318 CTGGGAGTTTGGAAGGGTGAGGG - Intronic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122977379 14:105176443-105176465 CTGGGAGTGTGCAAGCAGGATGG - Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124223082 15:27866349-27866371 CAGGTGGTCTGGCAGGAGGGAGG + Intronic
1125238971 15:37550738-37550760 CCTGTGGTCTTGAAGGAGGATGG - Intergenic
1125505121 15:40263460-40263482 CTGGGGGCCTGGGAAGGGGAGGG - Intronic
1125517716 15:40332019-40332041 CTGGGGGCCTGGAAAAAGGAGGG - Intronic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125770948 15:42165598-42165620 CTTGGGGATTGGAAGGATGAGGG - Intronic
1126179670 15:45772959-45772981 CAGCGGATCTGGAAGGACGAAGG - Intergenic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126674560 15:51148423-51148445 CTGGGTGTTTGGAAAGAGCATGG - Intergenic
1126676231 15:51161251-51161273 CTGGGGGTCTGGATCTAGGATGG + Intergenic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127854340 15:62942413-62942435 TTGGAGGTTAGGAAGGAGGATGG - Intergenic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1129252054 15:74314573-74314595 CTAGGGGGCTGGCAGGGGGAGGG - Intronic
1129461134 15:75700558-75700580 TTGGAGGTCTGGGAGGAGGGTGG + Intronic
1129723696 15:77891184-77891206 TTGGAGGTCTGGGAGGAGGGTGG - Intergenic
1129789867 15:78333766-78333788 CTGGTGGCCTGCATGGAGGATGG - Intergenic
1129852108 15:78799283-78799305 GTGGGGGTTTGGGAGGAGTAGGG - Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1129907020 15:79195581-79195603 GAGAGGGTCTGGAAGGTGGAAGG + Intergenic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1130250895 15:82299804-82299826 GTGGGGGTTTGGGAGGAGTAGGG + Intergenic
1130742743 15:86618809-86618831 CGGAGGGTCTGTAATGAGGAGGG - Intronic
1130942151 15:88519874-88519896 ATGGGAGTCTGGAAGGACTATGG - Intronic
1131105579 15:89731898-89731920 CTTGGGGGCTGGGAAGAGGAAGG - Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131977824 15:97963096-97963118 CTGGGGCTCAGGAAGGGTGAGGG - Intronic
1132578251 16:673785-673807 CTGGGGGTCCGGCAGGAGCCAGG - Exonic
1132618629 16:854251-854273 CTGGGCCTCTGGGAGGAGGGTGG + Exonic
1132654551 16:1036437-1036459 CTGGGGGTCTGGGAGCGGGGAGG + Intergenic
1132655691 16:1040908-1040930 CTGGGGGTCTGGGCAGAGGAGGG - Intergenic
1132655718 16:1040986-1041008 CTGGGGGTCTGGGAGGAGATGGG - Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655779 16:1041169-1041191 CTGGGGGTCTGGGAGCAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132666365 16:1082990-1083012 GTGAGTGTCTGGAAGGAGCATGG + Intergenic
1132836087 16:1954149-1954171 CTGGGGGGCAGGAAGGAAGGAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1134026271 16:10956412-10956434 CTGGGGGTCTGGTGAGAGCAAGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134301306 16:12993900-12993922 CTGGGGGACAGGAAAGAGGGAGG + Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135527712 16:23226830-23226852 CTGGGGGCTTCAAAGGAGGAAGG - Intergenic
1135730887 16:24894306-24894328 CTTGGGGTGGGAAAGGAGGAGGG - Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136570001 16:31090997-31091019 GTGCGGGTATGGCAGGAGGAGGG + Exonic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1137334480 16:47533989-47534011 CTTGGGGCCTGGGAGGAGGGGGG - Intronic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1138174091 16:54880475-54880497 CTGGTGTTCTGGAAGCAGGGAGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139504166 16:67390853-67390875 CTGGGGGGCTGGAACCAGGGAGG - Intronic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1140218641 16:73028023-73028045 CTGGCGGCCTGGGAGGAGGTGGG - Intronic
1140344562 16:74200291-74200313 CTTGGGGTCAGGAAGGGGGAAGG + Intergenic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1140508312 16:75488587-75488609 CTGGGCATTTGGAAGGGGGAAGG + Intronic
1140893529 16:79305513-79305535 CTGAGGGTCTGCAAGGTGGATGG + Intergenic
1141642383 16:85348866-85348888 CTCGGGGGCTGGAGGGAGGGAGG - Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141935518 16:87235714-87235736 CCTGAGGCCTGGAAGGAGGAAGG + Intronic
1142179148 16:88658856-88658878 GCCGGGGTCTGGCAGGAGGAGGG - Intronic
1142613905 17:1124173-1124195 CGGGGGGGCTGGAAGGAGCAGGG + Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1142931974 17:3292821-3292843 CTGGGGGGCGGGTTGGAGGAGGG - Intergenic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143109611 17:4545754-4545776 CTGGGGGTCTGCAAGAGGGAGGG + Exonic
1145217196 17:21061283-21061305 CTTGGGGGCTGGAAGCAGGCAGG - Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145880676 17:28350700-28350722 CTGGGGGTCAGGGTGGAGGTGGG - Intronic
1145894627 17:28447222-28447244 CTGGGGGTCTGCAATAAGGGCGG + Intergenic
1146063047 17:29617085-29617107 CTGGGGGTCCCGAAGTAGCACGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1146623591 17:34419335-34419357 GTAGGGGTCAGGCAGGAGGATGG - Intergenic
1146634066 17:34491185-34491207 TCTGGGGTCTGGGAGGAGGAAGG + Intergenic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146677652 17:34784629-34784651 CTGGGGTGCTGGCAGGGGGAAGG - Intergenic
1146693674 17:34893261-34893283 CATGGGGTCAGGAAGGAGGGTGG + Intergenic
1146835418 17:36106827-36106849 CTGGGGCTCTGGAATGATGAGGG - Intergenic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147141620 17:38463602-38463624 CAGGGTATCTGGAAGGAGGGTGG + Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148144707 17:45355804-45355826 CTAGGGTTTTTGAAGGAGGAAGG + Intergenic
1148148819 17:45384009-45384031 CTGGGGGACTGGGAGGAGAGAGG + Intergenic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1148480312 17:47955731-47955753 ATGGGTTTCTGGAAGGAGGTGGG + Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148906928 17:50918032-50918054 CAGGAGGTCTGGAAGGCGGGGGG - Intergenic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149722884 17:58863722-58863744 CTGGGGTGCTGGAAAGGGGATGG + Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150381877 17:64727265-64727287 CAGGGGTTATGGTAGGAGGAAGG + Intergenic
1150520916 17:65866032-65866054 CTAGGGGTCTAGAAGCAGGCAGG + Intronic
1151360045 17:73583391-73583413 CTGGGGGTCTGCTACGAGGGTGG + Intronic
1151502361 17:74499244-74499266 CTAGGGGTAGGGTAGGAGGAAGG - Intergenic
1151523966 17:74651052-74651074 CCTGGGGTCTGGAAGCAGGAGGG + Intergenic
1151554598 17:74840388-74840410 CTGGGGGACAGGTAGCAGGAAGG - Intergenic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151966957 17:77436552-77436574 CTGAGGGTCTGCGTGGAGGAGGG - Intronic
1152127922 17:78458519-78458541 CAGGGGGTCTGAGAGCAGGAGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152540271 17:80971253-80971275 CTGGGGGGCTGCATGGACGATGG - Intergenic
1152552414 17:81036175-81036197 GTGGGGGTCTGGACCGAGAACGG - Intronic
1152611573 17:81317450-81317472 CTGGGGGTGTGGATAGAGTAGGG + Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1153487606 18:5615967-5615989 CTGGGGGTCTTCCAGAAGGAAGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1155337796 18:24783202-24783224 GTGGAGATCTGGCAGGAGGAGGG - Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1155927593 18:31673471-31673493 CTGGTGGTCAGCAACGAGGATGG + Intronic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156477275 18:37413737-37413759 ATGGGGCTCTGGAAGGATGTGGG - Intronic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156795875 18:41045582-41045604 CTGTGTGTCTGGAAGCAGAATGG - Intergenic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1157516943 18:48317969-48317991 CAGGGGGTGAGGAAGGAGGCAGG - Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1157716109 18:49888494-49888516 CTAAAGGTCTGGGAGGAGGAAGG + Intronic
1158221799 18:55158634-55158656 AGGGGGGTTTGGAAGGTGGAGGG - Intergenic
1159005074 18:63004115-63004137 CTGGGGGTCAGCAAGGAAGCTGG + Intergenic
1159826896 18:73224009-73224031 CTGGGGGACAGGAAGAGGGAGGG + Intronic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160357919 18:78244394-78244416 TTGGGGGTTTGGTTGGAGGAGGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160824379 19:1072828-1072850 CTGGTGGGCTGCATGGAGGAAGG + Intronic
1160895447 19:1400061-1400083 CTGGGGGTCTGCCTGGAGGGGGG + Intronic
1160895524 19:1400293-1400315 CTGGGGGTCTGCTTGGAGGAGGG + Intronic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161448262 19:4329811-4329833 CTGGGGGTGGGGGAGGGGGAGGG - Intronic
1161470739 19:4455739-4455761 CCGGGGGAGTGGGAGGAGGATGG + Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161632399 19:5364813-5364835 CAGGGGATGTGGAACGAGGATGG + Intergenic
1161742919 19:6035217-6035239 CTCTGGGTCTTGCAGGAGGAAGG + Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161979716 19:7624137-7624159 GTGGGGGTCTTGAAGGAGCCAGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163189787 19:15669344-15669366 TTGGGTTTCTGGAAAGAGGATGG + Intergenic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163368142 19:16887804-16887826 GGGGGGGTCTGGGAGCAGGAGGG - Intergenic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1163680049 19:18676046-18676068 ATGGGGGTCTGGATGTAGGGAGG + Intergenic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164618750 19:29681560-29681582 CTGGGGCCCTGGAAGGCGTAGGG - Intergenic
1164862749 19:31575495-31575517 TGGGTGGTCTGGAAGGAGGAGGG + Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165705768 19:37975275-37975297 CCGGGGACCAGGAAGGAGGATGG + Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165886896 19:39084788-39084810 CTGGGGGTCTGGGAGCGGGGTGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166050106 19:40254059-40254081 CTGGGGGGCAGGGAGGTGGATGG + Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166190963 19:41176250-41176272 CTGGGGCTCTGAGAGGAGAATGG + Intergenic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166222795 19:41376583-41376605 CCGGGGGTCTGGGAGCAGGCGGG - Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166340572 19:42134489-42134511 GAGGGGATCTTGAAGGAGGATGG + Intronic
1166347369 19:42175149-42175171 CTGGGGCTCTGGGAGGGGGAGGG - Intronic
1166380857 19:42354514-42354536 CCTGGGGTCTGGGAGGAGGAGGG - Intronic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166863145 19:45821172-45821194 CTGGGAGGAAGGAAGGAGGAGGG + Intronic
1167217074 19:48171779-48171801 CTGGGGGCCTGCGTGGAGGAGGG - Exonic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167743958 19:51340292-51340314 CGGGCCGTCTGGAGGGAGGAGGG + Exonic
1167917898 19:52756965-52756987 CAGGGAGGCTGGAAGGAGGGTGG + Intergenic
1167925009 19:52814151-52814173 CAGGGAGGCTGGAAGGAGGATGG + Intronic
1202700055 1_KI270712v1_random:157574-157596 GTGGGGGTCAGTAAGAAGGAGGG + Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
926163401 2:10503465-10503487 CTGGGGGTCTGGGAAGAGCCAGG + Intergenic
926249095 2:11143417-11143439 CTGAGGGGCTGAAAGGAGGTGGG + Intronic
926812776 2:16771122-16771144 CTGGGGCTCCGGAAGGAGAGAGG + Intergenic
927695492 2:25236887-25236909 CTGGGGGGCAGGGAGAAGGAAGG - Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927926832 2:27019364-27019386 GTGGGGGTATGGCAGGGGGATGG + Intronic
928024433 2:27728356-27728378 CTGGGGCTCTGGAAAGAGAATGG + Intergenic
928625537 2:33135966-33135988 CTGGGGGGGTGGTAGGAGAAGGG + Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929780993 2:44956840-44956862 CAGGTGGTCTGGAAAGAGGATGG + Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930495624 2:52138311-52138333 CTGGAGGTCTTGAAGGAGACAGG + Intergenic
931131465 2:59341159-59341181 CTGGAGATCTGGAAAGAGGGTGG + Intergenic
931149239 2:59554665-59554687 CTGGGGTTTTCGAAGGCGGAAGG - Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931763002 2:65432862-65432884 CTTGGTGTTTGGAAGGAGGGAGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932442924 2:71749247-71749269 CTGGGGTTCTAGAAGGAGGCAGG + Intergenic
932499762 2:72173505-72173527 CTGGAGCTTTGGAAAGAGGAAGG + Intergenic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
932743196 2:74307808-74307830 CTGGGGGCCTGGCATGGGGATGG - Intronic
933711410 2:85328470-85328492 CGTGGAGTCGGGAAGGAGGAGGG - Intergenic
934170987 2:89541049-89541071 GTGGGGGTCAGTAAGAAGGAGGG + Intergenic
934281292 2:91615367-91615389 GTGGGGGTCAGTAAGAAGGAGGG + Intergenic
934523534 2:95034615-95034637 CTGGGGGCCAGGATGGAGGCTGG - Intronic
934524578 2:95043748-95043770 CTGGGGGACAGGGCGGAGGAGGG - Intronic
934662094 2:96148518-96148540 GGTGGGGGCTGGAAGGAGGAAGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935426362 2:102922310-102922332 AGGAGGGTCTGGAAGGTGGAGGG - Intergenic
936632039 2:114214362-114214384 CTTGGGGTGGGGAAGAAGGAAGG - Intergenic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937092992 2:119218791-119218813 CTGGGGGTCAGGAAAGAAGCAGG + Intergenic
937124306 2:119463654-119463676 CTGGGCATTTGGAAGGAGAAAGG + Intronic
937335899 2:121062230-121062252 CTGGGGGTTGGGAAGAAGGCAGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938316707 2:130334416-130334438 CTGGGGGGCTGGGAGGATTATGG - Intergenic
938324865 2:130391534-130391556 CCGGGGGTCTGGAACGCGCACGG + Intergenic
938500933 2:131831083-131831105 CTGGGGGTGGGCAAGGCGGAGGG + Intergenic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939678677 2:145104123-145104145 CTGGGGGTGGGGAAGCTGGATGG - Intergenic
940036890 2:149320722-149320744 CTGGGGCTCAGGAAGTAGAAGGG - Intergenic
941670105 2:168283961-168283983 CTGGAGGGACGGAAGGAGGAGGG + Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942077858 2:172373431-172373453 CTCAGGGACTGGGAGGAGGAAGG + Intergenic
942116187 2:172731365-172731387 ATGGTGGTCTGGGATGAGGAAGG + Intergenic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
942181402 2:173384355-173384377 CTGGAAGACTGGAAGGATGAAGG - Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942523595 2:176829864-176829886 CAGGGGGTCTGGAAACAGCAAGG + Intergenic
942627071 2:177912594-177912616 CTGAGGGTCTGGAAATAAGAGGG - Intronic
942998203 2:182291150-182291172 TGGAGGGTCTAGAAGGAGGATGG - Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944689849 2:202149137-202149159 CTGGGGGTAGGGGAGAAGGAGGG - Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945924104 2:215786282-215786304 CGGGGGGTCTGCAAGCTGGAAGG - Intergenic
946048768 2:216843289-216843311 CAGGGGGCCTGGAAGGAAGGGGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946182042 2:217954747-217954769 CTGGGAGGCTGGATGGTGGAAGG - Intronic
946290597 2:218741660-218741682 CTGCTTTTCTGGAAGGAGGATGG - Intronic
946445940 2:219740045-219740067 CTGGGGGCCAGGGAGGAGGCAGG + Intergenic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947587052 2:231362858-231362880 TTTGGGGTCAGGCAGGAGGAAGG - Intronic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
948274396 2:236697008-236697030 GTGGGGGACTGGATGGATGATGG + Intergenic
948534743 2:238637513-238637535 CTGCTGGCCTGGAAGAAGGAAGG + Intergenic
948788686 2:240366051-240366073 CTGGGGGTCAGGGAGCATGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1169388440 20:5170325-5170347 CAGAGGGTCTGGAAGCAGGCAGG - Intronic
1169665769 20:8033716-8033738 CTGAGGTTCTGGAAGGTGGCTGG + Intergenic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1169958486 20:11132114-11132136 TCAGGGGTTTGGAAGGAGGAGGG + Intergenic
1170223444 20:13965110-13965132 CAGGAGGTCAGGAAGTAGGAAGG + Intronic
1170326180 20:15156780-15156802 CTGAGGGTCTGCTAAGAGGAAGG - Intronic
1170937618 20:20823697-20823719 GTCAGGGCCTGGAAGGAGGAAGG - Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171287414 20:23952629-23952651 CTTGGGTTCAGGCAGGAGGAAGG + Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172048951 20:32101603-32101625 GTGGGTGTCTGGGAGTAGGAAGG - Exonic
1172176085 20:32972706-32972728 CTGGGGGTCTGGGTGTGGGATGG + Intergenic
1172450858 20:35021653-35021675 CTGGGGGTCTGGTTGGTGGCAGG - Intronic
1172457116 20:35086041-35086063 GTGGGGGGCTGGGAGGGGGAAGG - Intronic
1172614684 20:36275347-36275369 CTGGGGCTCTGGAAGGAGGCAGG + Intergenic
1172638036 20:36423065-36423087 ATGGGGGGCTTGAATGAGGACGG - Intronic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1172951006 20:38723650-38723672 TTGGGGGTCTGGAAGAAGGCAGG - Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1174112282 20:48205034-48205056 CTGGGGGTCTGGCAGCAGGAGGG + Intergenic
1174184979 20:48699980-48700002 CTGGGGGTTTGGGAGGTGAATGG - Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174870143 20:54174110-54174132 GAGGGGGGGTGGAAGGAGGATGG + Intergenic
1175022569 20:55865960-55865982 CTGGGGGTTATGAAGCAGGATGG - Intergenic
1175183920 20:57167105-57167127 CAGGCAGTCTGGAAGCAGGAGGG + Intergenic
1175229626 20:57465531-57465553 CTTGGGGTGTGGATGTAGGAAGG + Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175401507 20:58702060-58702082 CAGGAGGTCTGGAAGGAGCAGGG + Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175714127 20:61244313-61244335 CTGGGGTTCTGGGAAAAGGATGG + Intergenic
1175935071 20:62510474-62510496 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175935098 20:62510550-62510572 GTGGAGGTGTGGAAGGTGGAGGG - Intergenic
1175965936 20:62660309-62660331 CTGGAGGTCTGCCCGGAGGAGGG + Intronic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176122192 20:63458892-63458914 CTGGGGGGCTGAGATGAGGAGGG + Intronic
1176161908 20:63652664-63652686 CGCGGGGTCTGGATGGGGGAGGG - Intronic
1176274478 20:64255945-64255967 CCGGGGGTGGGGAAGGAGGAGGG - Intronic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178355572 21:31908396-31908418 CTAGGGGCCTGTAAGGAGGCTGG + Intronic
1178839607 21:36128343-36128365 CAGGGATTCTGGAAGGAGCACGG - Intergenic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180960543 22:19760600-19760622 CTGGGGGCCGGGGAGGGGGAAGG + Intronic
1181161716 22:20963706-20963728 ATGGAGGGCTGGAAGCAGGAGGG - Intergenic
1181695914 22:24592786-24592808 CTGGGGGTCTGGGAGGCGCGGGG - Intronic
1181770069 22:25118844-25118866 CCTGGCGTCTGGAAGGAGCAGGG - Intronic
1182038280 22:27216361-27216383 CTGGGGGTCTGAATGGGGGTGGG + Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182978143 22:34642588-34642610 CTGGTGGTCAGGAAGGACTACGG + Intergenic
1183265734 22:36824062-36824084 CTGGGGCTCTGGAAAGAGGGTGG + Intergenic
1183471169 22:38007485-38007507 CTGGGAGCCTGGGAGGTGGAAGG + Intronic
1184236848 22:43187313-43187335 GCGGGGGGCTGGGAGGAGGACGG - Intergenic
1184236903 22:43187414-43187436 CGGGGGGGCCGGGAGGAGGACGG - Intergenic
1184296397 22:43527943-43527965 CTTGGGCTCAGGAAGGCGGAGGG + Intergenic
1184370277 22:44077543-44077565 CTGGCGGTCTGGAAGAAGATAGG - Intronic
1184455424 22:44607259-44607281 CCGGTGGTGGGGAAGGAGGATGG + Intergenic
1184688829 22:46108377-46108399 CTGGTGCTCAGGGAGGAGGAGGG + Intronic
1184754353 22:46507863-46507885 CTGGGGGGCTGCATGGAGAAAGG + Intronic
1184810259 22:46826580-46826602 CTGGTGTCCTGGAAGGTGGATGG + Intronic
1184813350 22:46852314-46852336 CTGGGGTTCTGGAAGAGGGGAGG - Intronic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185207575 22:49548867-49548889 CCGGAGGTCTGGGTGGAGGAGGG + Intronic
1185272507 22:49935639-49935661 ATGGGGGTCCGGGAGGAGCAGGG + Intergenic
1185272598 22:49935847-49935869 CTGGGGGTCTGGGAGAAGGAGGG + Intergenic
1185272631 22:49935919-49935941 GTGGGGGTCCGGGAGGAGCAGGG + Intergenic
1185272647 22:49935954-49935976 GTGGGGGTCCGGGAGGAGCAGGG + Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950831207 3:15878028-15878050 CTCGGGGTCTGGCAGCAGCATGG + Intergenic
952561765 3:34603630-34603652 AAGGGGATCTGGAAGGGGGATGG - Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
952933894 3:38380383-38380405 CTAAGGGTCTGTAAGGAGGTTGG + Intronic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
954416127 3:50394287-50394309 CTGAGGGTCTCGTAGGATGAGGG - Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
954688279 3:52382433-52382455 CTGGGTGTCTGAGAAGAGGAAGG - Exonic
954689100 3:52386441-52386463 CCTGGGGGCTGGAATGAGGAGGG - Intronic
954892043 3:53939618-53939640 CTGGGGGTCTGTCATGAAGATGG - Intergenic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955456632 3:59128760-59128782 CTGGGGCCCTGCCAGGAGGAAGG - Intergenic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
956583867 3:70843225-70843247 CTGGGGGTATGGTTAGAGGAAGG + Intergenic
956736607 3:72243392-72243414 CAGGTGGGCTGGGAGGAGGAGGG + Intergenic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957392333 3:79592897-79592919 CTAGGGGTTCGGAAGGGGGAGGG - Intronic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959987910 3:112597801-112597823 ATGGGGGTTTGGCAGGTGGAAGG - Intergenic
960018803 3:112925430-112925452 CTGGTGGTGAGGAAGGAGGGAGG + Intronic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
961200589 3:125042626-125042648 CTGGGAGTTTGGAAGGGGCAAGG + Intronic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
962371379 3:134823452-134823474 CTGGGGGTCTTGGGGAAGGAAGG + Intronic
962747845 3:138410797-138410819 CTGGGGAACTGGGAGGAGAAGGG - Intergenic
962968023 3:140371986-140372008 CTGGGGATCTGGGTGGAGCAGGG + Intronic
963601172 3:147380255-147380277 CTGGGCTTCTGGGAGAAGGATGG - Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
964088253 3:152844526-152844548 CTGAGAGTATGGAAGGAGTATGG + Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964198048 3:154087384-154087406 CTAGGTGTATGGAAGGATGATGG - Intergenic
964810653 3:160660256-160660278 CTGGGGATTTGGAAAGAGAATGG + Intergenic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
965929324 3:174023339-174023361 CTGGGGGTCTGCCTGGAGGCAGG + Intronic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
966688784 3:182723486-182723508 CTAGGGTTCTGTAATGAGGAGGG + Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
968222063 3:196947038-196947060 GTGGGAGTCATGAAGGAGGACGG + Exonic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968704668 4:2072347-2072369 CTTGGGGTCTGGGAGGTGGCTGG - Intronic
968814920 4:2817330-2817352 CAGGGCGGCTGGAAGGAGGTGGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
968972225 4:3802053-3802075 CTTGGGGCCTGGGAGGAGCATGG - Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969421860 4:7102209-7102231 CTAGGCGTCTGGAGAGAGGAAGG - Intergenic
969891740 4:10266314-10266336 CGGGAGGTCTGCAAGGAGGGAGG + Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
970244397 4:14044229-14044251 CTAGAGGTCTGGAAGGATAACGG - Intergenic
970959538 4:21856607-21856629 CTTGGGGGCTGGAAGTAGGCAGG + Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971742677 4:30540152-30540174 ATGGGGATCTGGAAAGGGGATGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
971828175 4:31654955-31654977 GTTGAGGTCTGGAAGGAGTATGG - Intergenic
971968777 4:33594968-33594990 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
972011448 4:34188393-34188415 CTCGGGGTCTGTAAAGAAGAAGG + Intergenic
972221370 4:36959527-36959549 TTGGGGCTCTGCCAGGAGGAAGG - Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
973652125 4:53006804-53006826 CTGGAAGTCAGGAAGGAGCATGG + Intronic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975935079 4:79569918-79569940 ATGATGGTGTGGAAGGAGGATGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
978498363 4:109384135-109384157 CTTGGGGTCTGGGAGCAGGCAGG + Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979537608 4:121841311-121841333 TTGGGAGGCTGGAAGGTGGAAGG + Intronic
979647396 4:123087525-123087547 CTGTGCTTCTGGCAGGAGGAAGG - Intronic
980744871 4:137000653-137000675 CTTGGGGGCTGGGAGCAGGAGGG + Intergenic
980948251 4:139345578-139345600 CTGAGCTTCTGGAAGAAGGATGG + Intronic
981390782 4:144189232-144189254 CTGGTGGTCTAGAAGGAACAGGG - Intergenic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
981777437 4:148386115-148386137 CCTGGGGGCTGGGAGGAGGAGGG - Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983512269 4:168621491-168621513 CTGGGGTGGTGGAAGGAGTAAGG - Intronic
983904241 4:173168521-173168543 CTGCGGATCTGGAAGGGGGCAGG + Intergenic
984515857 4:180738337-180738359 CTGCACATCTGGAAGGAGGATGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985163289 4:187065976-187065998 CTGGGCATCTGGACGGAGGGAGG + Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985288030 4:188356993-188357015 GTGGGGTTCTGGAAAGAGCAGGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985691448 5:1314920-1314942 CCAGGGGTCTGGAGGAAGGATGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
985964296 5:3328094-3328116 CTAGGGGTCTGGAAGGGGTTGGG + Intergenic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
986282274 5:6333404-6333426 CTGGGGATCTGGATGGTGGCAGG + Intergenic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
986773546 5:10994448-10994470 GCGGGGGCCGGGAAGGAGGAAGG + Intronic
986952959 5:13113381-13113403 AAGGGGGCCTGGAAGGAGGAAGG + Intergenic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
988400100 5:30751366-30751388 CCAGGGGTCTGGAAGGAAAAGGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990388137 5:55288704-55288726 CTGGTGGTATGGAAGGAGTTAGG + Intronic
990716263 5:58640394-58640416 CTCGGAGTGTGGAATGAGGAAGG + Intronic
990919856 5:60950843-60950865 CTAGGGGTTTGGTAGCAGGAAGG - Intronic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
991630419 5:68651059-68651081 CAGGCAGGCTGGAAGGAGGAAGG - Intergenic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
991935936 5:71800302-71800324 CTGGGGTTCAGAAAGGAGGCTGG + Intergenic
992140254 5:73789381-73789403 GCTGGGGTGTGGAAGGAGGATGG + Intronic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992609502 5:78495083-78495105 CTGGGGGACTGGCAGGACTATGG - Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993754495 5:91711065-91711087 TTGGGGGCCTGGGAGGAGGAAGG + Intergenic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994010303 5:94894614-94894636 ATGTGTCTCTGGAAGGAGGAGGG + Intronic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
995581667 5:113608628-113608650 CTTGGGGGCTGGAAGCAAGATGG + Intergenic
996741088 5:126799588-126799610 CTGAGGGTCCAGAAGAAGGAAGG + Intronic
997013353 5:129904422-129904444 CGGGGGCTCGGGAAGGAGGGAGG + Intergenic
997153574 5:131526723-131526745 CTGGTGGGCTGGAAGGACAATGG - Intronic
997747409 5:136311217-136311239 AGTGGGGTCAGGAAGGAGGAGGG + Intronic
998034410 5:138901996-138902018 CAGGAGGCCTGGGAGGAGGAAGG - Intronic
998184583 5:139968561-139968583 GCAGGGGACTGGAAGGAGGAAGG + Intronic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999493430 5:152073670-152073692 TAGGGGGTCTGGAGAGAGGAGGG + Intergenic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1000574457 5:162959711-162959733 AAGCGGGTCTGGAAGGAGAAAGG + Intergenic
1001590777 5:172863461-172863483 CTGGCCGTCAGGAAGGAGGTGGG - Intronic
1001597793 5:172909136-172909158 CTGGGGCTCAGGAAAGAGAAGGG - Intronic
1001724457 5:173885392-173885414 CTGGAAGTATGGAAGAAGGAAGG - Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001919975 5:175592087-175592109 CCAGGCGTCAGGAAGGAGGAAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002280857 5:178129448-178129470 GTGAGGGTTAGGAAGGAGGAGGG - Intergenic
1002434142 5:179220989-179221011 AGAGGGGTCAGGAAGGAGGAGGG - Intronic
1002444423 5:179280378-179280400 CTGGGGGCCTGCAAGGGGGCAGG - Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002497407 5:179624456-179624478 CTGGGGCCCTGGCACGAGGAGGG + Exonic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1003273687 6:4629706-4629728 CTGGGTGGCTTGTAGGAGGAAGG + Intergenic
1003483106 6:6551160-6551182 GTGAGGATCTGGAAGGAGGCAGG + Intergenic
1003841243 6:10122221-10122243 CTGGGGGTGAGGGAGGAGTAGGG + Intronic
1003961546 6:11213608-11213630 CAGGGGGACTGGAAGGATGGTGG - Exonic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004335801 6:14763261-14763283 CTGGGGGTCGGGGCGGAGGCAGG + Intergenic
1004495566 6:16159773-16159795 CTGAGGGTCAGCAAGAAGGATGG + Intergenic
1005200883 6:23342791-23342813 TTGGGGGGCTGGAAAGGGGATGG - Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005928338 6:30463248-30463270 CTGGGGGTGTGGAATTGGGAGGG - Intergenic
1006025331 6:31143180-31143202 CTAGAGGTGTGGAAAGAGGATGG - Intronic
1006276580 6:33009187-33009209 TTGGGTCTCAGGAAGGAGGAAGG + Intronic
1006418734 6:33920418-33920440 CTGGGAGTCAGGAAGGTGCAGGG - Intergenic
1006441678 6:34057267-34057289 GGGGGCGTCTGGGAGGAGGAGGG - Intronic
1006443372 6:34065602-34065624 CTGGGGTCCTGGCAGGAGGCTGG - Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1006933535 6:37701809-37701831 CTGGGGGTGTGGGATGAGGAGGG - Intergenic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1007764665 6:44153550-44153572 CTGGGGCCCGGGCAGGAGGAGGG + Intronic
1007766205 6:44161775-44161797 CTGGGGGCCTGGAAGGACCAGGG - Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008286294 6:49655268-49655290 CAGAGGCTCTGCAAGGAGGAAGG - Intergenic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1009702629 6:67202707-67202729 TTGGGGGTGTGGAAGGTGGGTGG + Intergenic
1010760213 6:79714107-79714129 CCTGGGTTCTGGAAGGAGGTGGG + Intergenic
1011249868 6:85359762-85359784 CTGGGACTCAGGGAGGAGGATGG + Intergenic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011404723 6:87006919-87006941 CGGGGGGAGTGGAAGGAGGCAGG + Intronic
1011634916 6:89362719-89362741 CTCGGGGTCTGTATGAAGGATGG + Intergenic
1012690110 6:102299895-102299917 CTCAGGGTCTGCAAGGATGAAGG - Intergenic
1012752672 6:103183771-103183793 CTTGGGGTCTGGGAGCAGGCAGG + Intergenic
1013803270 6:113970751-113970773 CTGAGGGGTGGGAAGGAGGAGGG - Intronic
1014150203 6:118045652-118045674 ATGAGGTTCTGGAAGGAGGATGG + Intronic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015626404 6:135183359-135183381 CTGGGGGTTAGGAAGAGGGAGGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016940394 6:149478692-149478714 CTGGGGCCCTGGGAGAAGGAGGG - Intronic
1016967139 6:149729414-149729436 GTGGGTGACTGGAAGGCGGAAGG + Intronic
1017400071 6:154050620-154050642 ATGGGGGGCTGGGAGGAGGTGGG + Intronic
1017597713 6:156047018-156047040 CAGGTGGTCAGGCAGGAGGAAGG - Intergenic
1017766417 6:157610576-157610598 CTGGAGGTCAGGATGGAGGGAGG + Intronic
1018982756 6:168613223-168613245 CTGGGGGTCAGGAAGGTGCAGGG + Intronic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019415844 7:926222-926244 CTGGCGGTCTGGGAGGGGAACGG - Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019851324 7:3561073-3561095 CTAGGGGTGGGGAAGGGGGAAGG - Intronic
1020726295 7:11819647-11819669 CTAGGGATTTGGGAGGAGGAAGG + Intronic
1020901549 7:14009652-14009674 CTGAGGGGCTGGATGGAGGGAGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022125447 7:27352074-27352096 CTGGGGTTCTGGCAGTAGGGTGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022704219 7:32787727-32787749 TTGGGGGTCTGGGAAGGGGATGG + Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1022908402 7:34877469-34877491 TTGGGGGTCTGGGAAGGGGATGG + Intronic
1023319242 7:38975863-38975885 CTGGGGGTGTGGGTGGAGGTGGG - Intergenic
1023594899 7:41818816-41818838 CTAGGGGTCTGGAAGAGGTAAGG - Intergenic
1023963001 7:44943258-44943280 CTAGGGGTTTGGAAAGAAGAGGG + Intergenic
1024095519 7:45979567-45979589 CTGGAGGTCAGGAAGGAGCTAGG + Intergenic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024272862 7:47655597-47655619 CTGCCAGGCTGGAAGGAGGAGGG + Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026449619 7:70516270-70516292 GCGGGTGTGTGGAAGGAGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028606574 7:92662312-92662334 TTGGGGGTGTGGAAGTAGGTTGG + Intronic
1028640675 7:93039379-93039401 CTTGGGGGCTGGAAGCAGGCAGG + Intergenic
1028947867 7:96601356-96601378 ATAGGGGTTTAGAAGGAGGATGG + Intronic
1029124965 7:98289401-98289423 CTGGGGGTCTGGACTCATGAGGG - Intronic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032306083 7:130733657-130733679 CACGGGGTCTGGACGGAGCACGG + Exonic
1032448513 7:132004995-132005017 CAGTGGGTCTGGCAGGAGCAAGG + Intergenic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1034183113 7:149153986-149154008 CTGGGGGTGTAGGAAGAGGAAGG - Exonic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034377559 7:150659422-150659444 AGGTGGCTCTGGAAGGAGGAGGG - Intergenic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1034527574 7:151675466-151675488 GTCGGGCTCTGGAAGGAAGACGG + Exonic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034718747 7:153267751-153267773 ATGGGGTTGTGGAAGGAGTATGG + Intergenic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035031576 7:155864434-155864456 CTCGGGGTCGGGAACGAAGAAGG - Intergenic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035253961 7:157614294-157614316 CGGGGGTTCTGGAAGGGGGCAGG + Intronic
1035356768 7:158280350-158280372 CTGGGGGTCGGTAAGGACGCTGG + Intronic
1035374981 7:158401920-158401942 CTGGCGGTCTGGATGGAGAGAGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1036160911 8:6387883-6387905 CTAGGGCTCTGAAAGGAGCAAGG - Intergenic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037147004 8:15584701-15584723 GTGGGGGTGGTGAAGGAGGAGGG + Intronic
1037292176 8:17362655-17362677 TTAGGGGCCTGGAACGAGGAAGG - Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038271766 8:26081403-26081425 TTTGGGGACTGGAGGGAGGAGGG - Intergenic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038363114 8:26902635-26902657 CTGAGGGTCTGGAATGTGGTAGG + Intergenic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1039546957 8:38417305-38417327 CTGGGGGCCTGCACGCAGGATGG - Exonic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1040354057 8:46598623-46598645 CTGGGGGTTTAGGAGGAAGAGGG + Intergenic
1040807051 8:51406578-51406600 GTGAGGGACTGGAAGCAGGAAGG - Intronic
1041292167 8:56318431-56318453 CTGTGGATCTGCAAGGATGAGGG + Intronic
1041414235 8:57589904-57589926 CTGGGGCTCTGGAACAAGCATGG + Intergenic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043479291 8:80637049-80637071 CTGGGGGTGGGGGAGGGGGACGG - Exonic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044026999 8:87184663-87184685 CTGGGGGCCAGGAAGGAGTCTGG + Intronic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045547937 8:103144525-103144547 GTGGGGGTCTCCAAGGAGAAAGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047006085 8:120621864-120621886 CTGGGGATCGGGGAGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048336086 8:133503516-133503538 GTGGGGGGCTGGACGGAGGGAGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048754507 8:137722049-137722071 CTAGGGGTATGGAAGAAGGAAGG + Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049242579 8:141545698-141545720 CAGGGGGTATGGAAGGGGCAGGG - Intergenic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049482749 8:142834727-142834749 TTGAGGGTCCGGAAGGAGGGCGG + Intronic
1049512948 8:143038921-143038943 CCGGGGTTCTGGAAGCAGGGAGG + Intergenic
1049570500 8:143368218-143368240 CGGAGGTTCTGGAAGGAGGCGGG + Intergenic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049794038 8:144488386-144488408 CTGGGGCTGTGGGAGCAGGAGGG + Intronic
1049826373 8:144671496-144671518 CTGGGGGTCAGGGAGCAGGTGGG - Intergenic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1050009793 9:1173611-1173633 CTGGAGGTCTGGAAGGATCTAGG - Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050432781 9:5578884-5578906 CTTGGGGACTGGAAGGTGGGAGG - Intergenic
1050585292 9:7104415-7104437 CTGGGGCCCTGGAAGGAGTGAGG + Intergenic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051716675 9:19991938-19991960 CTTGGGGACTGGATGGATGAGGG + Intergenic
1052443502 9:28529156-28529178 CTGAGGTACTGGAAGGAGAATGG - Intronic
1052995220 9:34548242-34548264 CTGGGGGTCTGGATAGGGGTGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1055912026 9:81364047-81364069 CTGGGGGTTTGGCAGGGGCATGG + Intergenic
1056334214 9:85550226-85550248 CAGGGGATCTGGAAGGAGCTAGG + Intronic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057691599 9:97291268-97291290 CAGGGTGTCTGGCGGGAGGAGGG + Intergenic
1057830936 9:98406463-98406485 CTGGGGTGCTGGAAAGATGACGG + Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1059306026 9:113353908-113353930 CTGGGGTTCTGGGATGAAGACGG + Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059701777 9:116782010-116782032 ATGGGGCTCTGGAAAGAGTATGG - Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1060093359 9:120764563-120764585 CTGGTGTTGTGGAAGGAGCACGG - Exonic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060811166 9:126612328-126612350 CTGGGAGTCTGGAAGGTTGCAGG + Intergenic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061407150 9:130398646-130398668 CTGGTGGTCTGGTGGAAGGACGG + Intronic
1061534792 9:131240854-131240876 CTGGGGGCCTGGAAGTGGTAGGG - Intergenic
1061972499 9:134052629-134052651 CTTGGGGTCTGGAGAGAGGTTGG - Intronic
1061993483 9:134172659-134172681 CTGAGGGCCTGAAAGAAGGAGGG + Intergenic
1062097981 9:134712495-134712517 AAGGGGGACAGGAAGGAGGAGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062388441 9:136324497-136324519 CTGGGGCTCTGGACGGAGGTGGG - Intergenic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062566788 9:137167171-137167193 CTGGGGGTCTGGGCAGGGGAGGG + Intronic
1062589712 9:137268017-137268039 CTGGGGGCCTTGACGGGGGAGGG + Intronic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187308360 X:18117208-18117230 CTGAAGCTCTGGAAGGGGGAAGG + Intergenic
1187533058 X:20113960-20113982 CTGGGGGGTGGGAAGGAGGTAGG - Intronic
1188013001 X:25077233-25077255 CCTGGGGACAGGAAGGAGGATGG - Intergenic
1188159511 X:26783161-26783183 CTTGGGGGCTGGAAGCAAGATGG - Intergenic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1191900447 X:66034771-66034793 GTGGGGGTGGGGAAGGAGGTGGG + Intronic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193809700 X:86036891-86036913 CTGGGAGTCTGGTATGTGGAGGG + Intronic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195569167 X:106380066-106380088 AATGGGGACTGGAAGGAGGATGG - Intergenic
1196083582 X:111659740-111659762 CTGGGGGTGTGGAATTAGGGTGG - Intergenic
1196346353 X:114664366-114664388 CTGGAGGTGGGGAAGGAGGAGGG - Intronic
1196630527 X:117934122-117934144 CTGGGATTCTAAAAGGAGGAAGG + Intronic
1197967339 X:132079194-132079216 CTCAGAGTCTGGAAGTAGGATGG - Intronic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198179678 X:134194104-134194126 CTGGGGGCCTGTCAGGAGGTGGG + Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic