ID: 1032068874

View in Genome Browser
Species Human (GRCh38)
Location 7:128791766-128791788
Sequence GTGGAGAGACGCGCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032068874_1032068883 7 Left 1032068874 7:128791766-128791788 CCCTCCCCAGCGCGTCTCTCCAC 0: 1
1: 0
2: 1
3: 21
4: 282
Right 1032068883 7:128791796-128791818 CGACGGTGCTTCCAGCCTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 83
1032068874_1032068879 -10 Left 1032068874 7:128791766-128791788 CCCTCCCCAGCGCGTCTCTCCAC 0: 1
1: 0
2: 1
3: 21
4: 282
Right 1032068879 7:128791779-128791801 GTCTCTCCACTTCAGTCCGACGG 0: 1
1: 0
2: 0
3: 7
4: 80
1032068874_1032068882 6 Left 1032068874 7:128791766-128791788 CCCTCCCCAGCGCGTCTCTCCAC 0: 1
1: 0
2: 1
3: 21
4: 282
Right 1032068882 7:128791795-128791817 CCGACGGTGCTTCCAGCCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032068874 Original CRISPR GTGGAGAGACGCGCTGGGGA GGG (reversed) Intronic
900084068 1:878800-878822 CTGGAGAGATGAGCTGGGGTGGG - Intergenic
900183469 1:1322564-1322586 GGGGAGGGACGGGGTGGGGAAGG + Intronic
900199529 1:1397994-1398016 GTGGCGGGTCGCGCTGGGGCTGG - Intronic
900367487 1:2317141-2317163 GTAGAGAGACGGGGTGGGGATGG - Intergenic
900738845 1:4318099-4318121 GAGGAGAGACAGGCTGGAGATGG - Intergenic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902362171 1:15947906-15947928 GTGGGGAGAGGTGATGGGGAAGG - Intronic
902448862 1:16484342-16484364 GAGGAGCGCCGCGGTGGGGACGG + Intergenic
902505907 1:16939011-16939033 GAGGAGCGCCGCGGTGGGGACGG - Exonic
903193549 1:21669391-21669413 GTGGGGAGCGGCGCCGGGGAAGG - Intergenic
903220968 1:21869567-21869589 GAGGAGAGAGCCCCTGGGGAGGG + Intronic
904420111 1:30385738-30385760 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
904935472 1:34126828-34126850 GGAGAGAGACGGGCAGGGGAGGG + Intronic
906220276 1:44072826-44072848 CTGGAGAGAAGAGCTGGAGAAGG + Intergenic
907274586 1:53310191-53310213 GGGAAGAGACGGGCTGGGGCAGG + Intronic
907364009 1:53945423-53945445 GTGAAGAGACGCGCGGCGGGAGG - Intronic
907474360 1:54695646-54695668 GTGGAGAGACAGGGAGGGGAGGG - Intronic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
908229213 1:62087189-62087211 GTGGAGAGGGGAGCTGGAGAGGG + Intronic
908656537 1:66394714-66394736 GTGGAGATTTGAGCTGGGGAAGG - Intergenic
917648298 1:177049898-177049920 GAGGAAAGAGGGGCTGGGGATGG + Intronic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
920035291 1:203061289-203061311 GAGGAGAGTTGGGCTGGGGAGGG + Intronic
921281818 1:213574975-213574997 GTGAAGAGACTGGCTAGGGAAGG + Intergenic
922554981 1:226526165-226526187 GTGGAGAGAGGCCCTGGAAAAGG - Intergenic
924775173 1:247111361-247111383 GTGGAGAGAGCCGCGGGGCAGGG + Exonic
1062763178 10:43136-43158 CTGGAGAGATGAGCTGGGGTGGG + Intergenic
1062926768 10:1321928-1321950 GAGGAGAGAGGCTCTGGGGGAGG + Intronic
1063004140 10:1952509-1952531 GAGAGGAGACGCGCTGGGAAAGG - Intergenic
1063953432 10:11244877-11244899 GAGGAAGGACACGCTGGGGAAGG - Intronic
1065323815 10:24533151-24533173 GTGGTGACAGGCGGTGGGGATGG - Exonic
1065979520 10:30878433-30878455 GTGGAGAGAGGAGCTGGAAAGGG - Intronic
1067280579 10:44869138-44869160 GTGCAGAGACGCAATGGGGAGGG + Intergenic
1070204471 10:74242897-74242919 GTGGAGAGGGGAGCTGGAGAGGG - Intronic
1072729690 10:97837386-97837408 GTGGTGAGAAGGGCTGGGGGTGG + Intergenic
1075903815 10:126063861-126063883 GAGGAGAGACACGCAGGGGATGG + Intronic
1076623206 10:131806226-131806248 GTGGGGACAGGTGCTGGGGAGGG - Intergenic
1078877424 11:15412417-15412439 GTGGAGAAAGGATCTGGGGAAGG + Intergenic
1080604408 11:33852887-33852909 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1081109869 11:39121475-39121497 GTGGAGAGGAGAGCTGGAGAAGG + Intergenic
1083476466 11:62918798-62918820 GTGGAGAGAACCACTGGGGGAGG + Intronic
1083726541 11:64631301-64631323 GTGGAGCTAGGGGCTGGGGAAGG + Intronic
1084129004 11:67119193-67119215 GTGGAGAGGCGAGCTGGAGGAGG + Intergenic
1084400572 11:68940665-68940687 CTTGAGAGACGCGGCGGGGAGGG - Intergenic
1084706908 11:70820873-70820895 GCAGAGAGACAGGCTGGGGACGG + Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087043353 11:93822777-93822799 GTAGAGATACGAGCTGGGCATGG - Intronic
1087309292 11:96521480-96521502 GTGGAGAGATGCTGTGGGGCTGG + Intergenic
1091294076 11:134460265-134460287 GTGGAGTGATGGGCTGGGGGTGG + Intergenic
1092283969 12:7118140-7118162 GTGGGGAGACAGGCTGGGGTGGG + Intergenic
1092618512 12:10237344-10237366 GTGGAGAGGGGAGCTGGAGAGGG - Intergenic
1093480015 12:19594686-19594708 GTGGAGAAATGCGATGGGGTTGG + Intronic
1093592331 12:20917661-20917683 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1094070729 12:26410274-26410296 GGGGAGAGAAGTGCTGGTGACGG + Intronic
1094813065 12:34160907-34160929 CTGGAGAGATGAGCTGGGGTGGG + Intergenic
1096626884 12:52901358-52901380 GTGGAGAGGGCAGCTGGGGAAGG - Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1096870560 12:54589687-54589709 GTGGAGAGAAGAACTGGGGATGG + Intergenic
1097106722 12:56630214-56630236 GTGGAGACGCCCGCTGGGGAGGG + Intronic
1098241080 12:68467884-68467906 GAGAAGAGACGCACAGGGGAAGG - Intergenic
1098488373 12:71047447-71047469 GTGGAGAGGAGAGCTGGAGAGGG + Exonic
1101593827 12:106145931-106145953 GTGCAGGGACGTGCTGGGGTCGG + Intergenic
1103613143 12:122136071-122136093 GTGCTGAGACCTGCTGGGGAAGG - Intronic
1103922160 12:124404653-124404675 GAGGAGAGCTGCGGTGGGGAAGG - Intronic
1104311522 12:127657810-127657832 GTGGGGAGACGAGGTGGGGGCGG - Intergenic
1104948187 12:132426764-132426786 GTGGCGAAACGCGCTGGGCGGGG + Intergenic
1104994542 12:132645288-132645310 CTGGAGAGGCGAGCTGGAGAGGG + Intronic
1105404422 13:20121553-20121575 GGGAAGAGACGCGCAGGGCAAGG + Intergenic
1106475724 13:30096479-30096501 GTGGAGAGATGCACAGGGCAAGG + Intergenic
1107045148 13:35985701-35985723 CAGGAGAGACTGGCTGGGGATGG + Intronic
1113760374 13:112842379-112842401 GGTGAGAGCCGGGCTGGGGAGGG + Exonic
1113792598 13:113037070-113037092 GTGCAGAGAGGGGCTGGGGGAGG + Intronic
1113796384 13:113061101-113061123 GATGAGAGAAGGGCTGGGGAGGG + Intronic
1116056100 14:39865879-39865901 GTGGAAAGACACTCTGGAGAAGG + Intergenic
1117293340 14:54354575-54354597 CTAGAGAGCAGCGCTGGGGAAGG - Intergenic
1119663258 14:76466123-76466145 GCGGAGAGCAGCCCTGGGGAAGG - Intronic
1121425920 14:93852037-93852059 GTGGAGAGAAGAGATGGGGAGGG - Intergenic
1122666753 14:103334934-103334956 CTCGGGGGACGCGCTGGGGATGG + Intronic
1122883929 14:104702241-104702263 GGGGAGGGAGGCGCTAGGGAAGG - Intronic
1122970825 14:105151547-105151569 GTGGGGCAACTCGCTGGGGATGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124712957 15:32030437-32030459 GTGGAGAGGCGCGCGGGGGCGGG + Intergenic
1125460140 15:39898633-39898655 GTAAAGAGACGAGCTAGGGAGGG + Intronic
1126065464 15:44822882-44822904 GTGGAGGGACGGGGTAGGGAAGG + Intergenic
1126066335 15:44828905-44828927 GTGGAGGGGCGCTCTGGGGGAGG - Intergenic
1126093547 15:45071961-45071983 GTGGAGGGGCGCTCTGGGGGAGG + Intronic
1126563923 15:50075182-50075204 TTGGAGACACGTGTTGGGGATGG + Intronic
1126975762 15:54178278-54178300 GTGGAGAGAAGATATGGGGAGGG - Intronic
1128357252 15:66936771-66936793 GTGCAGAGGGACGCTGGGGAAGG - Intergenic
1129016808 15:72475204-72475226 GTGGGGAGGTGCGCTGGGGGCGG + Intronic
1129113306 15:73350939-73350961 GTGGAGAGGAGCGCTGGGTGAGG - Intronic
1129412206 15:75356274-75356296 GGGGTGGGACGTGCTGGGGACGG - Exonic
1131367770 15:91854120-91854142 CTCGAGAGCCGGGCTGGGGAAGG - Intronic
1131439526 15:92448402-92448424 GTGGAGGAATGGGCTGGGGAGGG + Intronic
1132520199 16:383763-383785 GAGGAGAGGCGGGGTGGGGATGG + Intronic
1132687922 16:1170055-1170077 CTGGAGAGGCGAGCGGGGGAGGG - Intronic
1132724117 16:1331480-1331502 GTGGAGGGTCGCCCTGGGGCAGG + Intergenic
1132737993 16:1396960-1396982 GTGGAGAGACTCGCTGGCTGAGG + Intronic
1132903039 16:2268585-2268607 TCGGAGAGACGGGCTGGGGCAGG + Intergenic
1133051646 16:3120396-3120418 GAGGAGAGAGGGGCTCGGGAAGG + Exonic
1133201316 16:4206370-4206392 GTGGAGGGACGTGCAGGGAATGG - Intronic
1135483566 16:22843813-22843835 GTGGAGACCCTCTCTGGGGAGGG + Intronic
1135711995 16:24725536-24725558 ATGGAGAGAGGAGCTGGGGAGGG - Intergenic
1136267594 16:29130543-29130565 GGGAGGAGACGTGCTGGGGAGGG - Intergenic
1136520400 16:30792032-30792054 TTGGAGAGAGGAGCTGGGAAGGG + Intergenic
1137512510 16:49114108-49114130 GTGCAGAGACGTGCTTGGCAAGG - Intergenic
1138090178 16:54167545-54167567 GTGGAGAGAAGGGTTGGAGAGGG + Intergenic
1138110084 16:54316777-54316799 ATGGAGAGAGGTGCTGGGGATGG - Intergenic
1139353614 16:66353568-66353590 GTGGCGGGGGGCGCTGGGGAGGG + Intergenic
1141195988 16:81861738-81861760 GTGGAGAGAGGCACTGAGGGTGG - Intronic
1141676885 16:85522385-85522407 GGGGAGGGATGGGCTGGGGAGGG - Intergenic
1141677793 16:85526610-85526632 GTGGAGAGCAGGGATGGGGAGGG + Intergenic
1142271050 16:89089414-89089436 GAGGAGAGGTGCCCTGGGGAGGG - Intronic
1142722159 17:1783663-1783685 GTGGAGAAAGGCGCTAGGGGAGG + Intronic
1143172126 17:4936427-4936449 GTGGTTAGACTGGCTGGGGATGG - Intergenic
1143523803 17:7461389-7461411 GTAGAGACCCACGCTGGGGAAGG + Exonic
1143706775 17:8703541-8703563 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1144317963 17:14081985-14082007 GTGGAGAGACCCAGTGGGGCAGG + Intronic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1145784613 17:27585946-27585968 CTGGAGAGTCTCGGTGGGGAAGG - Intronic
1146526324 17:33570004-33570026 GTGGAGAGGAGTGATGGGGAGGG - Intronic
1147647715 17:42043672-42043694 GTGGAGGGACTCACTGGGGCAGG + Intronic
1147896642 17:43755766-43755788 GTGGAGAGAGGCGCGCGTGAGGG + Intronic
1148912108 17:50948368-50948390 TGGGAGATACGTGCTGGGGAGGG + Intergenic
1148936442 17:51167130-51167152 GGGGACAGACGCCCTTGGGAAGG + Intronic
1151018496 17:70584802-70584824 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1152024376 17:77799101-77799123 GTGGAGAGCCACACAGGGGAAGG + Intergenic
1152470446 17:80488050-80488072 GGGGAGGGACGCGGTGGAGAGGG + Intergenic
1152470587 17:80488591-80488613 GGGGAGGGACGCGGTGGAGAGGG + Intergenic
1152893949 17:82899103-82899125 GAGGACACACGCGCTGCGGACGG - Intronic
1152904603 17:82963329-82963351 CTGGAGGTTCGCGCTGGGGATGG - Intronic
1152956087 18:43467-43489 CTGGAGAGATGAGCTGGGGTGGG + Intergenic
1153006121 18:500257-500279 TTGCAAAGACGCGATGGGGAGGG + Intronic
1155310456 18:24518076-24518098 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1155812876 18:30260448-30260470 GTAGAGAGACTTCCTGGGGAGGG + Intergenic
1155840208 18:30633618-30633640 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1156354611 18:36330505-36330527 GTGAAGAGAGCCTCTGGGGATGG + Intronic
1156465035 18:37343373-37343395 GTGTAGACACGGGGTGGGGAGGG + Intronic
1156911640 18:42417547-42417569 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1158960202 18:62581949-62581971 GTGGAGAGTCACCTTGGGGAAGG + Intronic
1161879431 19:6937462-6937484 GTGGAGGGATGCGGTGGGGAAGG - Intronic
1164659487 19:29949922-29949944 GTGGGGAGACGGGAGGGGGAGGG + Intronic
1166785398 19:45364122-45364144 GCGGAGAGATGAGCTGGGGCTGG + Intronic
1166837606 19:45677132-45677154 GAGGAGAGGCGCGCTGGGTTGGG - Intronic
1166852498 19:45767336-45767358 CTGCAGAGAAGCGCTGGGGAGGG + Intronic
1168350947 19:55675254-55675276 GCGGAGAGCCGGGCGGGGGAGGG - Intronic
1202714255 1_KI270714v1_random:33653-33675 GGGGAGAGAGGGGCGGGGGATGG + Intergenic
925056336 2:860455-860477 GCAGAGACAGGCGCTGGGGAAGG - Intergenic
925414064 2:3657218-3657240 GCTGAGAGACGGGCTGGGGTTGG + Intergenic
925420168 2:3704415-3704437 GTGGAGAGGGGCGTGGGGGAGGG + Intronic
925420257 2:3704613-3704635 GTGGAGAGGGGCGTGGGGGAGGG + Intronic
925982178 2:9185832-9185854 GAGGAGAGACGTGCTGGTCAAGG - Intergenic
926125236 2:10267860-10267882 GTGGAGGGCAGGGCTGGGGAGGG - Intergenic
927093178 2:19727944-19727966 GTGGAGGGAGCCCCTGGGGAAGG - Intergenic
927685661 2:25168736-25168758 GCGGGGAGACGCGCTGGAAAGGG + Exonic
927881400 2:26692571-26692593 CTGGGGAGACGCGCCGAGGAGGG - Intergenic
932363512 2:71130259-71130281 GTTGAGAGACGCGCGGCAGAGGG + Intergenic
933728672 2:85440616-85440638 GTGGAGAGACTGGCCGGGCACGG - Intergenic
934517297 2:94996707-94996729 CTGGGGAGAGGAGCTGGGGATGG + Intergenic
934683736 2:96305532-96305554 CAGGAAAGACGCACTGGGGAAGG + Intergenic
938397416 2:130961804-130961826 GTGGGGAGAAGTGCTGGGGAAGG - Intronic
938771197 2:134502720-134502742 GTGGAGAGAAACACTGGGCAAGG - Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
942262479 2:174182752-174182774 CTGGAGAGACCTGCTTGGGAAGG - Intronic
944715876 2:202376067-202376089 CCGGAGAGACGCGCTGCGGTGGG + Intergenic
944894053 2:204145980-204146002 CTGGGGAGACGGGCCGGGGAGGG - Intergenic
945978033 2:216285748-216285770 GTGGAGAGACATGCTGGGGGAGG + Intronic
946090556 2:217219008-217219030 GTAGAGACAAGGGCTGGGGAGGG + Intergenic
946322432 2:218961679-218961701 GTGGGGAGAGGCGGTGGGGGTGG - Exonic
946326133 2:218985467-218985489 CCGGGGAGACGCGCGGGGGATGG + Exonic
946908991 2:224442386-224442408 GTGGAGGGGCGCGGTGGGGCGGG - Intergenic
947745995 2:232507671-232507693 GGGGAGACACTGGCTGGGGATGG - Intergenic
948248573 2:236507015-236507037 GTGGTGGGACGCGTAGGGGAGGG + Intronic
948310876 2:236985689-236985711 GTGGAGAGCTAGGCTGGGGAAGG - Intergenic
948689359 2:239692152-239692174 CTGGAGAGAAGCGCTGAGCAGGG + Intergenic
1169390446 20:5186326-5186348 CTGGAGAGAGGCCATGGGGAAGG - Intronic
1171229846 20:23475526-23475548 GTGGAGAGAGGCACTGGACAAGG + Intergenic
1171333970 20:24366759-24366781 GTGGAGATATACGCTGGGAATGG - Intergenic
1172192131 20:33068521-33068543 GTGGAGAGGCGGGCAGGGGATGG + Intronic
1172618644 20:36306258-36306280 GGGGAGAGGAGCGCGGGGGAGGG - Intergenic
1172782242 20:37443722-37443744 GTGCACAGAAGTGCTGGGGAGGG + Intergenic
1173331172 20:42077518-42077540 GTGGGGAGACCCCCTGGGGGTGG + Exonic
1175657647 20:60786079-60786101 GTGGAGAGCCACGCTGGGGGAGG + Intergenic
1175816983 20:61888310-61888332 CTGCAGAGATGGGCTGGGGACGG - Intronic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1176872692 21:14096552-14096574 GTGAGGAGAAACGCTGGGGAAGG - Intergenic
1178885405 21:36480878-36480900 GTGGACAAACGCCCTGGGCATGG + Intronic
1180013669 21:45069018-45069040 GAGGAGAGCCGTGCTGGAGACGG - Intergenic
1180709130 22:17827803-17827825 GTGGAGAAATGAGGTGGGGAAGG + Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182743011 22:32582543-32582565 TTGTAGAGACGGGCTGGGGGTGG + Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1183931685 22:41239151-41239173 GTGGAGAGGCGGGCTGTGGCAGG - Intronic
1185184737 22:49392198-49392220 GTGGAGAGACATGATGGGGAGGG - Intergenic
1185315424 22:50176905-50176927 GAGGAGACACGGGCTGGGGCGGG - Intronic
1185384891 22:50527077-50527099 GTGGAGGGAGGCAGTGGGGACGG + Intronic
949506642 3:4734635-4734657 GTGGAGCCAAGAGCTGGGGATGG - Intronic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
950104466 3:10379415-10379437 GTGGGGATACGGGTTGGGGAGGG + Intronic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
951848010 3:27105335-27105357 GGGGAGAGACCCGCATGGGAGGG + Intergenic
952971288 3:38651757-38651779 GGGGAGAGAAGCCCAGGGGATGG + Intergenic
954681791 3:52349960-52349982 GTGGGAGGAGGCGCTGGGGAGGG - Intronic
954687045 3:52376709-52376731 GTAGAGTGACGGGCTGGGGCAGG - Intronic
954995222 3:54875173-54875195 CTGGAGAGACACTCTGGGAAGGG - Intronic
955828814 3:62979912-62979934 GGGGAGAGACGGGGAGGGGAGGG - Intergenic
960743018 3:120855770-120855792 GAGGAGAGACATGCTGTGGAGGG + Intergenic
962709100 3:138070852-138070874 GTGGTGAGAGGCTCTGGGGAGGG - Intronic
965216298 3:165868580-165868602 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
966190019 3:177263664-177263686 CTGGAGAGAGGAGCTGGGCAAGG + Intergenic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
968152235 3:196346027-196346049 GAGGAGAGACGGGCTGGAGTTGG + Intergenic
968358252 3:198124773-198124795 CTGGAGAGATGAGCTGGGGTGGG - Intergenic
969455829 4:7299095-7299117 GTGGTGAGACAGGCTGGGGGAGG + Intronic
974384248 4:61184316-61184338 GGGCAGAGATCCGCTGGGGATGG - Intergenic
975173428 4:71259490-71259512 GGGGAGAGAGAAGCTGGGGAAGG + Intronic
978902598 4:113970662-113970684 GAGGAGAGAGGGGCTGGGCAAGG + Intronic
985190291 4:187365491-187365513 GTGGGGAGAGGGGCTGGAGATGG - Intergenic
985348711 4:189035275-189035297 GTGTGGAGACGGGCAGGGGACGG - Intergenic
985354810 4:189107294-189107316 GTGGAGAAAAGTGCAGGGGAAGG - Intergenic
985440194 4:189978292-189978314 CTGGAGAGATGAGCTGGGGTGGG + Intergenic
985756716 5:1723704-1723726 GTAAAGAGACGCGCTGGGCCTGG - Intergenic
985991271 5:3563866-3563888 CTGGAGAGGCGGGCTGGGTAGGG + Intergenic
988603588 5:32661657-32661679 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
990466445 5:56075953-56075975 GTGAAGAGATTGGCTGGGGAGGG + Intergenic
990996419 5:61736595-61736617 GTGGAGAGGCGAGTGGGGGAGGG - Intronic
993293211 5:86101924-86101946 GTGGAGAGGAGAGCTGGAGAGGG - Intergenic
993937734 5:94024551-94024573 GTGGGGTGGCGGGCTGGGGAGGG - Intronic
994367088 5:98928674-98928696 GGGGACAGACGCGGAGGGGAAGG + Exonic
995853623 5:116572630-116572652 GTGGACAGAGGCTGTGGGGAAGG - Intronic
996087810 5:119322188-119322210 GTGGAGATAAACGCTGTGGAGGG - Intronic
998265504 5:140664928-140664950 GAGGAGAGGCCCGCTGAGGATGG + Exonic
998836122 5:146203990-146204012 TGGGAGAGGAGCGCTGGGGACGG + Intronic
1001884687 5:175278710-175278732 GTGGGGAGATGCTCAGGGGAAGG - Intergenic
1004348340 6:14868970-14868992 CTGGGGAGACGCCCTGGAGAGGG - Intergenic
1006302144 6:33199360-33199382 GGGGAGGGACTCCCTGGGGAAGG + Exonic
1006317383 6:33298654-33298676 GGGGAGAGACGGGGTGGGGTGGG + Intronic
1007715747 6:43855093-43855115 ATGAAGAGATGCCCTGGGGAGGG - Intergenic
1010556158 6:77281953-77281975 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1014740509 6:125143446-125143468 GTGGAGAGGGGAGCTGGAGAGGG + Intronic
1017985748 6:159441893-159441915 GTAGAGAGAGGCTCTGCGGAGGG - Intergenic
1019262882 7:91930-91952 GTGGAGTGAGTCACTGGGGAGGG + Intergenic
1019301936 7:309781-309803 GTGGAGAGAAACGCTGGGCAGGG + Intergenic
1019317137 7:391951-391973 GTGCAGAGAGGCCCTGGGAAGGG - Intergenic
1019478198 7:1254305-1254327 GTGGGGAGGGCCGCTGGGGACGG - Intergenic
1019563966 7:1670651-1670673 AGGGAGAGAGGCGCTGGGGAAGG - Intergenic
1019606793 7:1914021-1914043 GTGGACAGGCGTGCTGGGGGGGG - Intronic
1019751765 7:2735135-2735157 GGAGAGAGAGGCGCTGAGGAAGG - Intronic
1020173396 7:5863444-5863466 GTGGAGTGACGTGCTTGAGAGGG + Intergenic
1021034016 7:15774594-15774616 GTGGAGAGAAAAGCTGGAGAGGG - Intergenic
1021654790 7:22864389-22864411 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
1022624913 7:32025350-32025372 GTGTAGAGACGAGCTGGAGTGGG + Intronic
1026482476 7:70790471-70790493 CCGGAGAGACCCGCTGGGCAGGG + Exonic
1026874524 7:73871678-73871700 GTGGATTGAGGCGCTGGAGAAGG + Intergenic
1026918706 7:74139423-74139445 GTGGAGAGGGGAGCTGGAGAGGG - Intergenic
1026936604 7:74260114-74260136 GTGGTGAGAAGCGCTGGAGGAGG + Intergenic
1029556467 7:101273274-101273296 TTGGAGAGAATCCCTGGGGATGG + Intergenic
1032068874 7:128791766-128791788 GTGGAGAGACGCGCTGGGGAGGG - Intronic
1033361228 7:140640458-140640480 GTGCAGGGTCGAGCTGGGGAGGG - Intronic
1034497611 7:151431893-151431915 GTGGTGAGAAGCAATGGGGATGG - Intronic
1035260685 7:157659500-157659522 GGGCAGAGACGCACAGGGGAAGG + Intronic
1037335401 8:17786705-17786727 GTTGAGAGACTGGCTGGGGCTGG + Intronic
1037769403 8:21789764-21789786 GAGGGGAGACCGGCTGGGGAAGG - Intronic
1038215977 8:25562080-25562102 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1039436056 8:37559994-37560016 GTGAAGAGAAGCTCTGGGCAGGG - Intergenic
1043439006 8:80260447-80260469 GTGGAGAGGGGAGCTGGAGAGGG + Intergenic
1044699038 8:94949623-94949645 GGGGAGGGAAGCGCTGGGGCCGG + Intronic
1046653969 8:116873838-116873860 TTGTAGAGACGCTCTGGGGGAGG - Intronic
1047475713 8:125226935-125226957 GTGGAGATAGGGGTTGGGGAAGG - Intronic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1051278682 9:15420675-15420697 GTGGAGAATCCTGCTGGGGAGGG + Intergenic
1051996130 9:23219947-23219969 GTGGAGAGGGGAGCTGGGGAGGG + Intergenic
1052530387 9:29675607-29675629 GTGGATAGAAGGGCTGGGGCTGG + Intergenic
1053056683 9:34997113-34997135 GTGAAGAGACTCCGTGGGGAGGG + Exonic
1053073393 9:35114385-35114407 GCTGAGAGACTGGCTGGGGAGGG - Intronic
1053152344 9:35751004-35751026 CTGGAGGGAAGGGCTGGGGAAGG + Intronic
1053426220 9:38011903-38011925 GGTGAGAGAGGCGATGGGGATGG + Intronic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1055945327 9:81687971-81687993 GCGGACAGGGGCGCTGGGGAAGG - Intronic
1056059558 9:82870229-82870251 GTGGAGAGGGGAGCTGGAGAGGG - Intergenic
1057082465 9:92183324-92183346 CTGCTGAGATGCGCTGGGGAAGG + Intergenic
1057303895 9:93901648-93901670 GGGCAGAGACTCGATGGGGATGG + Intergenic
1059181845 9:112222591-112222613 GTGCAGAGACGGTGTGGGGAAGG - Exonic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1060521788 9:124298213-124298235 GTGGGGAGGCGCGAGGGGGAAGG - Intronic
1060643978 9:125262199-125262221 AGGGAGAGACGCGTGGGGGATGG + Intronic
1060793462 9:126500399-126500421 GTGCAGAAAGGAGCTGGGGAAGG - Intronic
1062151977 9:135024321-135024343 GTGGACAGAGGCGAAGGGGATGG + Intergenic
1062482621 9:136759462-136759484 GGGGTGAGAGGCCCTGGGGAGGG - Intergenic
1062742124 9:138181306-138181328 CTGGAGAGATGAGCTGGGGTGGG - Intergenic
1203652026 Un_KI270751v1:134435-134457 GTGGGGTGACGGGCTAGGGAAGG + Intergenic
1185618187 X:1435990-1436012 CTGGGGAGGCGCACTGGGGAGGG - Intronic
1186433726 X:9526133-9526155 GAGGAGAGACGGGCGGGGGAGGG + Intronic
1187267231 X:17746758-17746780 GTGCAGAGGCGAGCTGGGAAGGG + Intronic
1187317230 X:18207114-18207136 GTGCAGAGGCGAGCTGGGAAGGG - Intronic
1189129707 X:38485422-38485444 GGGGAGAGGCGGGGTGGGGAAGG + Intronic
1189129719 X:38485446-38485468 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189129731 X:38485470-38485492 GGGGAGAGGCGGGGTGGGGAGGG + Intronic
1189235102 X:39480877-39480899 GTGGAGAGGGGAGATGGGGAAGG + Intergenic
1189335781 X:40169988-40170010 GTGCCCAGGCGCGCTGGGGATGG - Intronic
1193111117 X:77731803-77731825 GTGGAGAGGGGAGCTGGAGAGGG - Intronic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1198275548 X:135095228-135095250 GGGGAGAGAAGAGGTGGGGAGGG + Intergenic