ID: 1032069383

View in Genome Browser
Species Human (GRCh38)
Location 7:128794487-128794509
Sequence CCTCCAGCTCTGTCTCCGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032069383_1032069393 28 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069393 7:128794538-128794560 GGCAGAACTGGAGGAGACCCGGG 0: 1
1: 0
2: 5
3: 38
4: 389
1032069383_1032069387 -8 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069387 7:128794502-128794524 GCTGGAGGAGCTGCGGGCTCAGG 0: 1
1: 0
2: 5
3: 56
4: 555
1032069383_1032069390 16 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069390 7:128794526-128794548 GCTGCAGCTGGTGGCAGAACTGG 0: 1
1: 0
2: 5
3: 36
4: 384
1032069383_1032069389 7 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069389 7:128794517-128794539 GGCTCAGGTGCTGCAGCTGGTGG 0: 1
1: 1
2: 3
3: 51
4: 481
1032069383_1032069388 4 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069388 7:128794514-128794536 GCGGGCTCAGGTGCTGCAGCTGG 0: 1
1: 0
2: 2
3: 29
4: 326
1032069383_1032069391 19 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069391 7:128794529-128794551 GCAGCTGGTGGCAGAACTGGAGG 0: 1
1: 0
2: 3
3: 40
4: 387
1032069383_1032069392 27 Left 1032069383 7:128794487-128794509 CCTCACGGAGACAGAGCTGGAGG 0: 1
1: 0
2: 0
3: 47
4: 282
Right 1032069392 7:128794537-128794559 TGGCAGAACTGGAGGAGACCCGG 0: 1
1: 0
2: 3
3: 27
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032069383 Original CRISPR CCTCCAGCTCTGTCTCCGTG AGG (reversed) Exonic
900015186 1:143855-143877 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900045454 1:502464-502486 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900067652 1:744194-744216 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
900246222 1:1637328-1637350 CCTGCAGCACTGTCACCGCGGGG + Intronic
900257451 1:1704470-1704492 CCTGCAGCACTGTCACCGCGGGG + Intronic
900405647 1:2491843-2491865 CCACCAGCACTGTCACCCTGTGG - Intronic
900405688 1:2492008-2492030 CCACCAGCACTGTCACCCTGTGG - Intronic
900662409 1:3791397-3791419 GCTCCAGCCCTGTCTCTCTGTGG - Intronic
902287110 1:15413877-15413899 TCTCCATCCCCGTCTCCGTGCGG + Intronic
902333346 1:15741626-15741648 CCTCCGGCTCTGACTCGGTGTGG - Intergenic
902511811 1:16970710-16970732 GCTCCAGCTCAGCCCCCGTGAGG - Exonic
903478719 1:23637982-23638004 CACCCAGCTCTGTCTCTGTGGGG + Intronic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
904330548 1:29755525-29755547 CTTCCAGCCCTGCCTCCCTGGGG - Intergenic
904618119 1:31760810-31760832 CCTAGAGCTCTGTCGCCCTGGGG + Intronic
904719989 1:32500615-32500637 GCTGCAGCGCTGTCTCCGAGGGG + Intronic
906067658 1:42993689-42993711 CCTCCAGCTCTGGCCAGGTGAGG + Intergenic
906653947 1:47534143-47534165 CCTCCAACTCTATCTCCATCTGG - Intergenic
907525393 1:55050978-55051000 TCTCCACCTCTGTCTCCACGTGG - Intronic
907664104 1:56418882-56418904 GCTCCAGAGCTGTCTCCATGAGG - Intergenic
907801361 1:57769030-57769052 CCTACAGCCCTGTGTCTGTGGGG + Intronic
912511810 1:110194884-110194906 GCTCCAGCTGTGTCCCAGTGTGG - Intronic
917387269 1:174491048-174491070 CCTCATGCTCTATCTCCCTGTGG + Intronic
917672556 1:177286805-177286827 CAGCCAGCTCTGTCATCGTGAGG + Intergenic
918149702 1:181787627-181787649 CTTCCAGATTTGTCTCCATGGGG - Intronic
920097536 1:203496332-203496354 CCTCCACCTCTTTCTCTGTGAGG + Intronic
920551669 1:206866624-206866646 CCTCCGGCTCTGTGTGAGTGTGG + Exonic
920926516 1:210346715-210346737 CTTCCTGCTCTGTCTCCCAGTGG + Intronic
922103015 1:222489588-222489610 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
922263336 1:223962076-223962098 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
923939871 1:238809778-238809800 CCTCCACCTCTGCCTCCAAGTGG - Intergenic
924345176 1:243067090-243067112 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1064397252 10:14991881-14991903 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1064400148 10:15014350-15014372 CCTGCACCTCTCTCTCCTTGCGG + Intergenic
1066390373 10:34973278-34973300 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1066731160 10:38437719-38437741 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1068128033 10:52865474-52865496 CCTTGAGATCTGTCTCCCTGTGG - Intergenic
1069738342 10:70672314-70672336 ACCCCTGCTCTGTCTCCGCGTGG + Intergenic
1070589143 10:77789213-77789235 CCCCCAGCACAGTCTCCATGTGG + Intergenic
1071573706 10:86711462-86711484 CCTCCACCTCCCTCTCCGGGAGG + Intronic
1072628391 10:97129042-97129064 CTTCCTGCTCTGTGTCCCTGGGG + Intronic
1072792415 10:98327855-98327877 TCTCCAGCTCTGTCTTGCTGTGG + Intergenic
1073768221 10:106707017-106707039 CCTCCAGCTCTGCCACTGTTTGG - Intronic
1074235621 10:111581797-111581819 CCTGCACCTCTGTCCTCGTGGGG - Intergenic
1075129567 10:119726343-119726365 CCTCCAGCTCCGACCCGGTGAGG + Exonic
1075618847 10:123910916-123910938 TCTCCACCTCTGCCTCCATGGGG + Intronic
1075725125 10:124607072-124607094 CCTCCAGCTCTGTCCCAGTAGGG + Intronic
1076369379 10:129941728-129941750 CCCCAAGCTCTGCCTCCTTGAGG - Intronic
1076780621 10:132722470-132722492 CCACCTGCCCTGTCACCGTGGGG + Intronic
1076852265 10:133099041-133099063 CCCCCAGCACTTTCTCCGGGAGG - Intronic
1076852303 10:133099149-133099171 CCCCCAGCACTTTCTCCGGGAGG - Intronic
1076852316 10:133099185-133099207 CCCCCAGCACTTTCTCCGGGAGG - Intronic
1076859189 10:133132523-133132545 CCCTCCGCCCTGTCTCCGTGCGG + Intergenic
1076971780 11:138955-138977 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1078248931 11:9601390-9601412 CCTCCAGCTCTGTCTCTGCTGGG - Intergenic
1081787449 11:45757387-45757409 GGGCCAGCTCTGTCTCTGTGAGG - Intergenic
1082262534 11:50088296-50088318 CCTCCGGCTCTGTGACCCTGTGG + Intergenic
1082997054 11:59263036-59263058 CCTCAAGATCAGTGTCCGTGAGG + Intergenic
1083410832 11:62491245-62491267 CCTCCAGCTCACCCTCCATGTGG + Intronic
1083430389 11:62611262-62611284 GCTCCACCTCTGTCTCCGTCTGG + Exonic
1083589393 11:63884342-63884364 CCTCCAGCTCACTCTCCTTCAGG - Intronic
1083623161 11:64058893-64058915 CCTCCAGCTGTGCCTGGGTGTGG - Intronic
1084086105 11:66856208-66856230 CCTCCCGCTCTGTCGCCGCCGGG - Intronic
1084125954 11:67099136-67099158 CCACCAGCTCTTTCTCCCCGGGG + Intergenic
1084261147 11:67979547-67979569 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1084797691 11:71519206-71519228 CCCTCAGCTCTGTCGCCGGGGGG + Intronic
1084807490 11:71589007-71589029 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1084847433 11:71911470-71911492 CCTGCACCTCTCTCTCCTTGGGG - Intronic
1085040806 11:73325233-73325255 CCTCCTGCCCTGTCTCCCTCTGG + Intronic
1089083532 11:115797742-115797764 CCTCCAGCTTTGTCTCCACATGG - Intergenic
1089109663 11:116045336-116045358 CCTCCTGCTCTGCCTCCCTCAGG - Intergenic
1089650207 11:119908024-119908046 TCTCCAGCTCTCTCTCCCTCTGG + Intergenic
1090952890 11:131489034-131489056 CATCAAGCTCTGCCTCTGTGAGG + Intronic
1091974198 12:4811436-4811458 CCTCCTGCTCCGTCTCCCGGTGG - Exonic
1092172997 12:6384877-6384899 CCTCCGGCTCCCTCTCAGTGAGG - Intronic
1092432408 12:8420103-8420125 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1093565866 12:20603035-20603057 CCTCCAACTCTTTCTCTGGGAGG - Intronic
1094498540 12:31004303-31004325 ACTCCAGCTCTTTCTTCCTGGGG + Intergenic
1094523799 12:31218845-31218867 CCTCCTGCTCTGTCGCAGTGGGG - Intergenic
1096135607 12:49197597-49197619 GCTTCATCTCTGTGTCCGTGTGG - Intronic
1096193306 12:49633754-49633776 GAGCCAGCTCTGTCTCCTTGTGG + Intronic
1096611591 12:52805567-52805589 CCTCCAGCCCTGTGTCCATGGGG - Intergenic
1096800568 12:54107624-54107646 CCTCCAGCACTTTCTACTTGCGG + Intergenic
1102484702 12:113247825-113247847 CTTCCATCCCTCTCTCCGTGTGG + Intronic
1102658279 12:114502179-114502201 CCTCCAACCCTTTCTCCCTGAGG + Intergenic
1103280251 12:119752091-119752113 CTTCCAGCTCTGTCTTCGCCTGG + Exonic
1103944754 12:124519843-124519865 CCTCCTGCTCTGTCTGTGTGTGG - Intronic
1104441740 12:128798916-128798938 CGTCCAGCTCAGTCTTCGTGAGG - Intronic
1104893407 12:132150839-132150861 TCTCCAGCTTTGTGTCCGTGGGG + Intronic
1104937783 12:132375772-132375794 CCCCCAGCTCTGCCTGCCTGAGG + Intergenic
1104970320 12:132528009-132528031 CCTCCATCTTTGTCCCCCTGGGG + Intronic
1104989636 12:132618584-132618606 CCCCCGGCTCTGTCCCCGCGAGG + Intergenic
1106249422 13:27972334-27972356 GCTCTAGCTCTGGCTCTGTGGGG - Intergenic
1107544189 13:41421669-41421691 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1107992987 13:45834616-45834638 CTTCCAGCTCAGTGTCTGTGGGG + Intronic
1110561186 13:76912205-76912227 CCTGCAGCTTTGTCTCCCAGGGG - Intergenic
1113708990 13:112452019-112452041 CTTCCCGCTCTGTCCTCGTGAGG + Intergenic
1113789576 13:113020690-113020712 CTCCCAGCACTGTCCCCGTGGGG + Intronic
1116203481 14:41830764-41830786 GCTCCTGCTCTGTCTCCTGGTGG + Intronic
1117038765 14:51751467-51751489 CCTGCACCTCTCTCTCCATGGGG - Intergenic
1118615909 14:67574347-67574369 CCTCCAGCTCTGCTTCGGGGTGG + Exonic
1119407365 14:74407157-74407179 CCTCCTGCTCTTTCTCTGTGGGG + Exonic
1122165283 14:99818629-99818651 GCTCCAGCTCTGACTCCTTCTGG - Intronic
1122643985 14:103179405-103179427 CCCCCAGCTCTGGCTCAGTGTGG - Intergenic
1122864084 14:104595695-104595717 CCTCCATCTCTGTCTGGCTGAGG - Intronic
1123118194 14:105904212-105904234 CATCCAGATCTGGCTCCGAGGGG - Intergenic
1124501042 15:30226070-30226092 CCTCCAGCACTGGCACCGAGGGG + Intergenic
1124742527 15:32312597-32312619 CCTCCAGCACTGGCACCGAGGGG - Intergenic
1124892139 15:33743201-33743223 CCACCAGCTCAGCCTCTGTGTGG + Intronic
1125682060 15:41537159-41537181 TCTCCAGCAGTGTCTCCGTGTGG + Exonic
1125766317 15:42138887-42138909 CCTCCAACTCTGTCACCTTCAGG + Intergenic
1125766409 15:42139547-42139569 CCTCCAACTCTGTCACCTTCAGG + Exonic
1128227620 15:66013156-66013178 CCTCCAGCTCAGCTTCCATGTGG - Intronic
1128783827 15:70380171-70380193 CCCCCAGCTCTGTCTGCTAGAGG - Intergenic
1129335472 15:74849882-74849904 CTTCCATCTCTGTGTCCTTGAGG + Intronic
1131121809 15:89827696-89827718 CCTCCCCCTCTGTCTCCTTGTGG - Intergenic
1131403125 15:92142411-92142433 CCTCTAGCTGTGTCTTCATGTGG + Intronic
1132201126 15:99955530-99955552 CCTCCAGCCCTCTCTCTGTAAGG - Intergenic
1132723998 16:1331029-1331051 CCTCAAGCTCTGACCCCGTCTGG + Intergenic
1133197989 16:4184360-4184382 CCTCCAGCCCTGTCCCCGCACGG + Intergenic
1136290244 16:29267361-29267383 CCGCCAGCCCTCTCTCAGTGGGG + Intergenic
1136926608 16:34380897-34380919 CTGCCACCTCTGCCTCCGTGAGG + Intergenic
1136977966 16:35030910-35030932 CTGCCACCTCTGCCTCCGTGAGG - Intergenic
1137613806 16:49835518-49835540 CCCCCAGCCCTGTCTCTGAGGGG - Intronic
1140126903 16:72125237-72125259 CCTCCAGCTCACTCTCCTGGTGG + Exonic
1140355554 16:74302902-74302924 CATCGAGCTCTGTCTTCCTGGGG + Intronic
1140659702 16:77176375-77176397 TCTCCAGATCTGTTTCCCTGTGG - Intergenic
1141689365 16:85587710-85587732 CCTCTAGCACTGGCTCCCTGAGG - Intergenic
1142005556 16:87688017-87688039 CCACCACCTCTCTCCCCGTGAGG - Intronic
1142096128 16:88240882-88240904 CCGCCAGCCCTCTCTCAGTGGGG + Intergenic
1142448467 16:90158567-90158589 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1142459018 17:76722-76744 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1142781179 17:2182432-2182454 CCTCTAGCTCTGTAACGGTGTGG - Intronic
1143622941 17:8091364-8091386 CCTCCATCTCCGTCTCCCTCAGG - Intergenic
1143764131 17:9126622-9126644 CCTTCTGCTCTGGCTCAGTGTGG + Intronic
1144423053 17:15115321-15115343 CCTCCACCTCTGTCTTCACGTGG + Intergenic
1144954086 17:19010438-19010460 CCCCCAGCTCTGCCTCCCCGGGG + Intronic
1145254464 17:21315054-21315076 CTTCCAGCTCACTCTCCCTGAGG + Exonic
1147429117 17:40361054-40361076 CATCCAGCTCTGTCTTGGGGTGG + Exonic
1148343681 17:46889384-46889406 TCTCCAGCTCTGCTTCCCTGTGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151752735 17:76050160-76050182 CCTCCAATTCTGTCTCCAGGTGG - Intronic
1152391641 17:80007251-80007273 CCCCCAGCACGGTCTCCGGGTGG + Intronic
1152452806 17:80393434-80393456 TCGCCAGCTGTGTCTCAGTGTGG + Exonic
1152565263 17:81097502-81097524 CCTACAGCTCTGACTCAGCGTGG - Intronic
1152846821 17:82605775-82605797 CCTCCACCTGTGTCTCCTAGGGG + Intronic
1153431565 18:5023040-5023062 TCTCCAGCTCTGGCTTCCTGAGG - Intergenic
1157569170 18:48700813-48700835 ACTCCACCTCTGTCTCCAAGAGG - Intronic
1160648737 19:209235-209257 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
1160682942 19:420281-420303 CCTCCAGCTCTGTCCCAGGCCGG + Intronic
1160725715 19:616979-617001 CCTCCAGCACTGGCACCGAGAGG + Exonic
1161638233 19:5402665-5402687 TCTCCAGCTCTTTCTCCTTCTGG - Intergenic
1161852407 19:6744610-6744632 CCTCCAGCTCGGCCTCCGACAGG - Exonic
1162019093 19:7860593-7860615 GCTCCAGCTCGGTCTCCAGGTGG - Exonic
1162497793 19:11033131-11033153 CCACCAGCTCTGTTTTCATGCGG + Intronic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163612422 19:18308358-18308380 CCTCCCTCTCTGTCTCCCTTGGG + Intronic
1163726796 19:18927758-18927780 CCTCCAGCTTCTTCTCTGTGGGG - Exonic
1164700583 19:30281384-30281406 CCTCCAGCCCTGTCTCCACCAGG + Intronic
1166976546 19:46608291-46608313 CCTGCAGCTCTGCTTCAGTGGGG - Exonic
1167096927 19:47379598-47379620 CCACCAGCCCTGTCTATGTGAGG - Intronic
1167293904 19:48638441-48638463 CCTCCACCTCTGCCTCCCTGTGG - Intronic
1167320919 19:48796772-48796794 CCTCCACCTCTCCCTCCCTGAGG + Intronic
1167608976 19:50497134-50497156 CATCCATCTCTGTCTCTGGGAGG + Intergenic
1168346700 19:55653301-55653323 TCTCCATCTCTGCCTCCGGGGGG - Intergenic
1168489884 19:56800018-56800040 TCTCCAACTCTGTCTCCTTAGGG - Intronic
927921053 2:26971868-26971890 CCTCCAGCTGTGTGTCTTTGTGG + Intronic
931966139 2:67536873-67536895 CCTCCTGCTCTGGCTGTGTGAGG + Intergenic
932349916 2:71023394-71023416 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
934839623 2:97616729-97616751 CCTCCAGCTCCCGCACCGTGAGG + Intergenic
935853543 2:107249174-107249196 TCTCCAGCTGTGTCTCCCTCTGG + Intergenic
935989441 2:108705912-108705934 CCTGGTGCTCTGTCTCAGTGTGG - Intergenic
937890763 2:126936807-126936829 GCACCACCTCTGTCTCAGTGAGG - Intergenic
940468454 2:154062691-154062713 CCACCAGGTCTGTCTCCCAGCGG + Intronic
940869494 2:158848171-158848193 CCTGCACCTCTCTCTCCTTGGGG - Intronic
940872168 2:158869169-158869191 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
946609973 2:221447574-221447596 CCTACAGATGTTTCTCCGTGGGG + Intronic
947594973 2:231405316-231405338 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1168915005 20:1478401-1478423 CCTGCACCGCTGTCTCCTTGGGG + Exonic
1170822814 20:19768451-19768473 CTTCCAGCTCTCTCTGCATGCGG + Intergenic
1171795888 20:29566734-29566756 CCTCCAGCACTTTCTACTTGGGG - Intergenic
1171852345 20:30317423-30317445 CCTCCAGCACTTTCTACTTGGGG + Intergenic
1174338579 20:49882300-49882322 CCTCCAGGTCTGGCTGCGGGAGG - Intronic
1174510777 20:51050720-51050742 CCTCCAGCACTGATTCCATGGGG - Intergenic
1175174341 20:57101901-57101923 ACTCCAGCTCTCTCTGCTTGAGG + Intergenic
1175291167 20:57876407-57876429 TCTCCAGGTCTGTCTCTGTGTGG + Intergenic
1178981395 21:37267835-37267857 CCTCCACCGCTTTCTCCCTGGGG + Intronic
1179366689 21:40765351-40765373 CCTCCTCCTCTGCTTCCGTGGGG + Intronic
1180238034 21:46477096-46477118 CCTCCTGCTCTTCCTCTGTGTGG + Intronic
1181003133 22:19997334-19997356 CCTCCAGCAGTGGCTCCCTGTGG - Intronic
1181019592 22:20092349-20092371 CCACCAGCTCTGTCTTCCTTGGG + Intronic
1181641896 22:24205779-24205801 CCCCCTGCTCTGTCTCTGTAAGG - Intergenic
1182031153 22:27160426-27160448 CCTCCTGCCCTGTCACTGTGTGG + Intergenic
1184244547 22:43229197-43229219 CCCCCAACTTTGTCTCCCTGTGG - Intronic
1184527968 22:45036690-45036712 CCTCCGGCTCTGTCTCCATCAGG - Intergenic
1184741026 22:46429142-46429164 TCCCTAGCACTGTCTCCGTGGGG + Intronic
949884528 3:8682754-8682776 CCTGCACCTCTCTCTCCTTGGGG - Intronic
950689825 3:14646835-14646857 CCTCCAGCCCTGTCTTCACGTGG - Intergenic
950891979 3:16412390-16412412 CCTTCAGCTCTTCCTCTGTGAGG - Intronic
952979674 3:38724516-38724538 CTTCCAGCTCAGTCTCTGTGAGG + Intronic
953023312 3:39129811-39129833 CCTCCAGATCCCTCTCCATGAGG - Intronic
954627887 3:52032695-52032717 CCTACAGCTGTGTGACCGTGGGG - Intergenic
956177938 3:66491156-66491178 CCTCCAGCTGTGGCTACTTGAGG - Intronic
957044420 3:75362925-75362947 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
959289243 3:104451522-104451544 CCTCCAGCTTTGACTACTTGAGG - Intergenic
961278004 3:125742701-125742723 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
961410691 3:126718071-126718093 CCTCCAGCTCTGACATCCTGTGG - Intronic
961876412 3:130026959-130026981 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
963922960 3:150923723-150923745 CCTCCAGCTCTCTCTTCTTCTGG - Intronic
964764168 3:160162484-160162506 CCTCCAGCTCTTTCTCTATCTGG - Intergenic
965231670 3:166061471-166061493 CTTCCTGCTCTGTCTCACTGTGG - Intergenic
965971934 3:174569926-174569948 CCTCTAGCTCTTTCTCTGTAAGG + Intronic
966473706 3:180320799-180320821 TCTCCAGCTCAGCCTCCCTGTGG - Intergenic
968369113 3:198210880-198210902 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
968500246 4:946573-946595 ACCTCAGTTCTGTCTCCGTGAGG + Intronic
968908785 4:3466320-3466342 GCTCCTGCGCCGTCTCCGTGGGG - Intronic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
968988684 4:3894165-3894187 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969019663 4:4131408-4131430 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969024367 4:4161808-4161830 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969025272 4:4167754-4167776 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
969132969 4:5004977-5004999 GCTCCAGCTCTTTCCACGTGTGG - Intergenic
969243825 4:5919480-5919502 CCTCCTGCACAGTCTCTGTGGGG - Intronic
969793776 4:9510064-9510086 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
971506281 4:27369787-27369809 CCTCCCTCTCTTTCTCCCTGGGG - Intergenic
974093491 4:57336729-57336751 ACTCCAGCTCTTTCACCATGTGG + Intergenic
975836877 4:78432460-78432482 CCTCCAGCATTGTCACTGTGAGG - Exonic
979257539 4:118620589-118620611 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
979330811 4:119419958-119419980 CCTCCAGCTCTGTGGCCCTGTGG + Intergenic
985682580 5:1264315-1264337 CGTCCACCTCTGCTTCCGTGTGG - Intronic
986468543 5:8050990-8051012 TTGCCAGCTCTGTCTCCCTGAGG - Intergenic
990281646 5:54257773-54257795 CCTCCAGCACTTTCTTTGTGTGG - Intronic
990382519 5:55231485-55231507 CCTCCAGCGCCGCCTCCGGGTGG + Exonic
990539897 5:56761758-56761780 CCTTCAGCTCTGTCTCTGATGGG + Intergenic
994007002 5:94849520-94849542 CCTCCATCTCTGTCTCACAGGGG + Intronic
994139870 5:96330341-96330363 CCACCATCTCTGTGTCAGTGAGG + Intergenic
996347304 5:122500950-122500972 TCTCAAGCTCTGTCTCCCTCTGG - Intergenic
997234341 5:132264080-132264102 CCTCCAGCCTTGACTCTGTGTGG + Intronic
997363089 5:133307724-133307746 CCCCCAACTCTGTCTCTGGGAGG + Intronic
1000072220 5:157751415-157751437 ACTCCATCGCTGTATCCGTGAGG + Exonic
1000398265 5:160798467-160798489 CCTCTACCTCTGTCTTCATGGGG - Intronic
1002728389 5:181316465-181316487 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1003089310 6:3088327-3088349 CCTTCACCTCTGTGTCAGTGGGG - Intronic
1004305035 6:14492841-14492863 CCTCCAAATCTGTCTTCCTGAGG - Intergenic
1005731707 6:28703675-28703697 TCTCCAGTTCTATCTCCTTGAGG + Intergenic
1006461570 6:34162213-34162235 CCTCCAGCTTTGCCCCCTTGGGG - Intergenic
1007619526 6:43203575-43203597 CCTCCAGCTCTGTCCCAGGTGGG + Exonic
1007685768 6:43666499-43666521 ACTCCTGCTCTGTGTCCATGAGG + Exonic
1007729485 6:43937257-43937279 CCACCATCTCTGTCTTCATGAGG + Intergenic
1010741948 6:79517538-79517560 TCTCCAAATCTGTCTCAGTGAGG - Intronic
1015850131 6:137563377-137563399 CCTCCAGCTTTGTTTTTGTGGGG - Intergenic
1017106635 6:150894365-150894387 TCTCCAGCTCTCTGTCTGTGAGG + Intronic
1017538373 6:155372968-155372990 GCTCCAGGTCTGCCTCTGTGTGG - Intergenic
1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG + Intronic
1018390236 6:163336211-163336233 CCCCCAGCTCTGCCTGCCTGGGG + Intergenic
1018868757 6:167765539-167765561 CCTGCAACTCTGTCTCTGTTGGG - Intergenic
1018918833 6:168156707-168156729 TCTCCACCTCTGTCTCCTTTTGG + Intergenic
1019345080 7:525718-525740 CCTCCAGCCCCTTCTCCATGAGG - Intergenic
1019537702 7:1537748-1537770 CCTCCAGCCCTGCCTCCGATGGG - Intronic
1019665071 7:2247737-2247759 GCTTCAGCTCTGTCTCCCGGCGG + Intronic
1020220745 7:6234711-6234733 CCTCCAGCTCTCCCACCGCGTGG + Intronic
1020311528 7:6872279-6872301 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1022657268 7:32330954-32330976 CCTCCTCCTCTGTCTCCTTGGGG + Intergenic
1022789213 7:33670143-33670165 CCCCAAGCACTGTCTCCCTGTGG + Intergenic
1023399523 7:39781864-39781886 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1024072461 7:45797653-45797675 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1025184712 7:56848757-56848779 CCTCCGGCTCTGTGGCCCTGTGG + Intergenic
1025687218 7:63728205-63728227 CCTCCGGCTCTGTGGCCCTGTGG - Intergenic
1025752601 7:64306705-64306727 CCTGCTGCCCTGTCTCCATGGGG - Intergenic
1026045052 7:66901421-66901443 CCACCAGCTCTGTGGCCCTGTGG - Intergenic
1026336674 7:69399558-69399580 CCTCCAGCTGTGTGTGGGTGGGG + Intergenic
1027333282 7:77122059-77122081 CTTCCGTCTCTGTCTCCGTCAGG - Intergenic
1029022072 7:97375316-97375338 CCTCCAGCTCTCTCTCTCCGTGG + Intergenic
1029078206 7:97952379-97952401 CCTGCAACTCTCTCTCCTTGGGG + Intergenic
1029582659 7:101447723-101447745 ACTCCAGCACCGTCACCGTGCGG - Exonic
1029782508 7:102749243-102749265 CTTCCGTCTCTGTCTCCGTCAGG + Exonic
1032049853 7:128641358-128641380 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1032069383 7:128794487-128794509 CCTCCAGCTCTGTCTCCGTGAGG - Exonic
1032543619 7:132724457-132724479 CCTCCAGCCCCTTCTCCATGTGG + Intronic
1034747255 7:153533872-153533894 TCACCAACTCTGTCTCCATGAGG - Intergenic
1034945313 7:155258188-155258210 CTTCCAGGTCTGTCTCCATCTGG + Intergenic
1035350998 7:158246429-158246451 CCCCCAGCTCTAACTCCGTGTGG + Intronic
1035386241 7:158474972-158474994 CCTCAGGGCCTGTCTCCGTGGGG - Intronic
1036000786 8:4601324-4601346 GCTCCACCTCTGTCTCCAAGGGG - Intronic
1036239805 8:7072124-7072146 CCTGCACCTCTCTCTCCTTGTGG - Intergenic
1036262072 8:7249030-7249052 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036304518 8:7590528-7590550 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036314111 8:7707569-7707591 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036355371 8:8038520-8038542 CCTGCACCTCTCTCTCCTTGGGG - Intergenic
1036816637 8:11907493-11907515 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1036903527 8:12689441-12689463 CCTGCACCTCTCTCTCCTTGGGG + Intergenic
1037328105 8:17715232-17715254 CATGCAGCTTTGTCTCAGTGGGG - Intronic
1038275602 8:26118301-26118323 CCTTTAGCTCTGTCTCCAGGTGG + Intergenic
1042485749 8:69343791-69343813 CCTGGAGCTCTGTGTTCGTGGGG + Intergenic
1044355667 8:91220145-91220167 GCCCCATCTCTGTCTCAGTGGGG - Intronic
1049226096 8:141451203-141451225 CTTCCTGCTGTGTCCCCGTGAGG - Intergenic
1049283790 8:141763665-141763687 TCTCCATCTCTGTCTCTCTGTGG + Intergenic
1052323458 9:27192824-27192846 ACTCCTGGTCTGTCTCCCTGGGG + Intronic
1053365790 9:37521641-37521663 TCTCCAGCTCTGTCTCCCAGAGG + Exonic
1053790131 9:41680701-41680723 CCTCCAGCACTTTCTACTTGGGG + Intergenic
1054178472 9:61892390-61892412 CCTCCAGCACTTTCTACTTGGGG + Intergenic
1054474798 9:65565164-65565186 CCTCCAGCACTTTCTACTTGGGG - Intergenic
1054659057 9:67688434-67688456 CCTCCAGCACTTTCTACTTGGGG - Intergenic
1056604760 9:88077102-88077124 CCGCCAGCTCTGTCTTCGCCTGG + Intergenic
1056865819 9:90226628-90226650 CCTGCATCTCTCTCTCCTTGGGG - Intergenic
1056917200 9:90756274-90756296 CCTGCATCTCTCTCTCCTTGGGG + Intergenic
1060933046 9:127500905-127500927 CCTCCAGCTCACTCACCATGGGG + Intronic
1061163189 9:128907680-128907702 CCTCCACCACTGTCTCCGACAGG - Exonic
1061727721 9:132590486-132590508 CCTCCTCCTCTGTCTCCATCTGG + Intergenic
1061883148 9:133577999-133578021 CCTGCAACTCTGTCTCCCTTGGG + Intergenic
1062044397 9:134418373-134418395 TCTTCATCTGTGTCTCCGTGTGG + Intronic
1062431091 9:136527181-136527203 GCTCCAGCTCTGTGGCCATGTGG - Intronic
1062683521 9:137798050-137798072 CTTTCAGCTCTGTTTCCCTGAGG - Intronic
1062753454 9:138273564-138273586 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1203575965 Un_KI270745v1:8343-8365 CCTCCAGCTCTGTGGCCCTGTGG - Intergenic
1185705026 X:2260399-2260421 CCTCCATCTCCATCTCCATGTGG + Intronic
1187096195 X:16151020-16151042 CCTCCTGCTTTGTCTCCATGTGG - Intronic
1189456683 X:41197258-41197280 CCTCCAGCTCTGTCTCGTTCTGG + Intronic
1189680755 X:43513521-43513543 ACTGAAGCTCTGTCTCCTTGGGG - Intergenic
1190411604 X:50141749-50141771 CCTGCAGCTCTGCCTCTGGGCGG - Intergenic
1190972714 X:55367370-55367392 CCTCCAGCCCTGTCTACTTCAGG - Intergenic
1196457337 X:115899782-115899804 TCTCCTGCTCTGTCTCTGTGTGG + Intergenic
1196886502 X:120251103-120251125 CCTCCGGCTCTTTCTTTGTGTGG + Intronic
1198408313 X:136339038-136339060 CCTCCAGCTGTCTCTCAGAGGGG + Intronic
1198443275 X:136685209-136685231 CCTCAAGTCCTGTCTCCGTAAGG + Intronic
1198469657 X:136934548-136934570 CCTGCACATCTGTCTCCTTGTGG + Intergenic
1198531196 X:137550740-137550762 CCTCCTTCTCCGCCTCCGTGGGG - Intergenic
1201142906 Y:11043200-11043222 TCTCCAGCACTGTCTCAGTGCGG + Intergenic