ID: 1032073383

View in Genome Browser
Species Human (GRCh38)
Location 7:128823791-128823813
Sequence CCCCGGTGCCAAAAAGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4838
Summary {0: 10, 1: 1010, 2: 1624, 3: 1333, 4: 861}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073383_1032073400 29 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073400 7:128823843-128823865 AGATGGAGAGGGGATGGGGATGG No data
1032073383_1032073392 12 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073392 7:128823826-128823848 GAAGACAATTTTTCCACAGATGG 0: 114
1: 243
2: 412
3: 397
4: 525
1032073383_1032073394 18 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073394 7:128823832-128823854 AATTTTTCCACAGATGGAGAGGG No data
1032073383_1032073389 -10 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073389 7:128823804-128823826 GGCACCGGGGACCGGTTTCATGG No data
1032073383_1032073397 24 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073397 7:128823838-128823860 TCCACAGATGGAGAGGGGATGGG No data
1032073383_1032073393 17 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073393 7:128823831-128823853 CAATTTTTCCACAGATGGAGAGG No data
1032073383_1032073396 23 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG No data
1032073383_1032073399 25 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073399 7:128823839-128823861 CCACAGATGGAGAGGGGATGGGG No data
1032073383_1032073395 19 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073383 Original CRISPR CCCCGGTGCCAAAAAGGTTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr