ID: 1032073385

View in Genome Browser
Species Human (GRCh38)
Location 7:128823792-128823814
Sequence TCCCCGGTGCCAAAAAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5010
Summary {0: 10, 1: 1014, 2: 1661, 3: 1391, 4: 934}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073385_1032073399 24 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073399 7:128823839-128823861 CCACAGATGGAGAGGGGATGGGG No data
1032073385_1032073394 17 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073394 7:128823832-128823854 AATTTTTCCACAGATGGAGAGGG No data
1032073385_1032073397 23 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073397 7:128823838-128823860 TCCACAGATGGAGAGGGGATGGG No data
1032073385_1032073393 16 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073393 7:128823831-128823853 CAATTTTTCCACAGATGGAGAGG No data
1032073385_1032073392 11 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073392 7:128823826-128823848 GAAGACAATTTTTCCACAGATGG 0: 114
1: 243
2: 412
3: 397
4: 525
1032073385_1032073395 18 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073385_1032073400 28 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073400 7:128823843-128823865 AGATGGAGAGGGGATGGGGATGG No data
1032073385_1032073396 22 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073385 Original CRISPR TCCCCGGTGCCAAAAAGGTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr