ID: 1032073388

View in Genome Browser
Species Human (GRCh38)
Location 7:128823797-128823819
Sequence ACCGGTCCCCGGTGCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073388_1032073401 29 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073401 7:128823849-128823871 AGAGGGGATGGGGATGGTTTCGG No data
1032073388_1032073393 11 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073393 7:128823831-128823853 CAATTTTTCCACAGATGGAGAGG No data
1032073388_1032073402 30 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073402 7:128823850-128823872 GAGGGGATGGGGATGGTTTCGGG No data
1032073388_1032073400 23 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073400 7:128823843-128823865 AGATGGAGAGGGGATGGGGATGG No data
1032073388_1032073395 13 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073388_1032073399 19 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073399 7:128823839-128823861 CCACAGATGGAGAGGGGATGGGG No data
1032073388_1032073396 17 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG No data
1032073388_1032073394 12 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073394 7:128823832-128823854 AATTTTTCCACAGATGGAGAGGG No data
1032073388_1032073392 6 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073392 7:128823826-128823848 GAAGACAATTTTTCCACAGATGG 0: 114
1: 243
2: 412
3: 397
4: 525
1032073388_1032073397 18 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073397 7:128823838-128823860 TCCACAGATGGAGAGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073388 Original CRISPR ACCGGTCCCCGGTGCCAAAA AGG (reversed) Intergenic
No off target data available for this crispr