ID: 1032073390

View in Genome Browser
Species Human (GRCh38)
Location 7:128823808-128823830
Sequence TCTTCCATGAAACCGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4711
Summary {0: 80, 1: 787, 2: 1189, 3: 1471, 4: 1184}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073390_1032073395 2 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073390_1032073402 19 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073402 7:128823850-128823872 GAGGGGATGGGGATGGTTTCGGG No data
1032073390_1032073399 8 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073399 7:128823839-128823861 CCACAGATGGAGAGGGGATGGGG No data
1032073390_1032073396 6 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG No data
1032073390_1032073393 0 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073393 7:128823831-128823853 CAATTTTTCCACAGATGGAGAGG No data
1032073390_1032073392 -5 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073392 7:128823826-128823848 GAAGACAATTTTTCCACAGATGG 0: 114
1: 243
2: 412
3: 397
4: 525
1032073390_1032073394 1 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073394 7:128823832-128823854 AATTTTTCCACAGATGGAGAGGG No data
1032073390_1032073400 12 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073400 7:128823843-128823865 AGATGGAGAGGGGATGGGGATGG No data
1032073390_1032073397 7 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073397 7:128823838-128823860 TCCACAGATGGAGAGGGGATGGG No data
1032073390_1032073401 18 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073401 7:128823849-128823871 AGAGGGGATGGGGATGGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073390 Original CRISPR TCTTCCATGAAACCGGTCCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr