ID: 1032073391

View in Genome Browser
Species Human (GRCh38)
Location 7:128823815-128823837
Sequence AAAATTGTCTTCCATGAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3422
Summary {0: 366, 1: 675, 2: 884, 3: 752, 4: 745}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073391_1032073395 -5 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073391_1032073394 -6 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073394 7:128823832-128823854 AATTTTTCCACAGATGGAGAGGG No data
1032073391_1032073400 5 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073400 7:128823843-128823865 AGATGGAGAGGGGATGGGGATGG No data
1032073391_1032073397 0 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073397 7:128823838-128823860 TCCACAGATGGAGAGGGGATGGG No data
1032073391_1032073402 12 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073402 7:128823850-128823872 GAGGGGATGGGGATGGTTTCGGG No data
1032073391_1032073393 -7 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073393 7:128823831-128823853 CAATTTTTCCACAGATGGAGAGG No data
1032073391_1032073399 1 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073399 7:128823839-128823861 CCACAGATGGAGAGGGGATGGGG No data
1032073391_1032073401 11 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073401 7:128823849-128823871 AGAGGGGATGGGGATGGTTTCGG No data
1032073391_1032073396 -1 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073396 7:128823837-128823859 TTCCACAGATGGAGAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073391 Original CRISPR AAAATTGTCTTCCATGAAAC CGG (reversed) Intergenic
Too many off-targets to display for this crispr