ID: 1032073395

View in Genome Browser
Species Human (GRCh38)
Location 7:128823833-128823855
Sequence ATTTTTCCACAGATGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032073391_1032073395 -5 Left 1032073391 7:128823815-128823837 CCGGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073383_1032073395 19 Left 1032073383 7:128823791-128823813 CCCCAACCTTTTTGGCACCGGGG 0: 10
1: 1010
2: 1624
3: 1333
4: 861
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073386_1032073395 17 Left 1032073386 7:128823793-128823815 CCAACCTTTTTGGCACCGGGGAC 0: 9
1: 985
2: 1738
3: 1417
4: 977
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073388_1032073395 13 Left 1032073388 7:128823797-128823819 CCTTTTTGGCACCGGGGACCGGT No data
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073385_1032073395 18 Left 1032073385 7:128823792-128823814 CCCAACCTTTTTGGCACCGGGGA 0: 10
1: 1014
2: 1661
3: 1391
4: 934
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data
1032073390_1032073395 2 Left 1032073390 7:128823808-128823830 CCGGGGACCGGTTTCATGGAAGA 0: 80
1: 787
2: 1189
3: 1471
4: 1184
Right 1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032073395 Original CRISPR ATTTTTCCACAGATGGAGAG GGG Intergenic
No off target data available for this crispr