ID: 1032074007

View in Genome Browser
Species Human (GRCh38)
Location 7:128827706-128827728
Sequence CAGGCTCAGGTTTCTGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032074002_1032074007 -2 Left 1032074002 7:128827685-128827707 CCGATTTATCCTGGAGAGCAACA No data
Right 1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG No data
1032073998_1032074007 11 Left 1032073998 7:128827672-128827694 CCTGAGTCAGGCCCCGATTTATC No data
Right 1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG No data
1032074001_1032074007 -1 Left 1032074001 7:128827684-128827706 CCCGATTTATCCTGGAGAGCAAC No data
Right 1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG No data
1032074000_1032074007 0 Left 1032074000 7:128827683-128827705 CCCCGATTTATCCTGGAGAGCAA No data
Right 1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032074007 Original CRISPR CAGGCTCAGGTTTCTGAGGA CGG Intergenic
No off target data available for this crispr