ID: 1032076284

View in Genome Browser
Species Human (GRCh38)
Location 7:128837669-128837691
Sequence GTCTGCACGGTGAAGTGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032076284_1032076296 18 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076296 7:128837710-128837732 CGAGGTGCTGGTCTACATCGAGG 0: 1
1: 0
2: 0
3: 6
4: 48
1032076284_1032076294 0 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076294 7:128837692-128837714 GGTGGACGCGGGCGTGGGCGAGG 0: 1
1: 0
2: 3
3: 52
4: 538
1032076284_1032076295 6 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076295 7:128837698-128837720 CGCGGGCGTGGGCGAGGTGCTGG 0: 1
1: 0
2: 1
3: 32
4: 274
1032076284_1032076297 28 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076297 7:128837720-128837742 GTCTACATCGAGGACCCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 42
1032076284_1032076292 -6 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076292 7:128837686-128837708 GCAGACGGTGGACGCGGGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 124
1032076284_1032076293 -5 Left 1032076284 7:128837669-128837691 CCTGCCCACTTCACCGTGCAGAC 0: 1
1: 1
2: 1
3: 8
4: 166
Right 1032076293 7:128837687-128837709 CAGACGGTGGACGCGGGCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032076284 Original CRISPR GTCTGCACGGTGAAGTGGGC AGG (reversed) Exonic
900757095 1:4443544-4443566 TGCTCCAGGGTGAAGTGGGCAGG - Intergenic
904501436 1:30915065-30915087 CTCTGCACAGAGAAGAGGGCAGG - Intergenic
905325862 1:37151685-37151707 GTCTGCCTGGTGATGTGGCCTGG - Intergenic
905769066 1:40625686-40625708 TTCGGCACGGTGGAGTGGGGAGG + Exonic
914748057 1:150513721-150513743 ATCTGCTCAGTGAAGGGGGCAGG - Intronic
919501264 1:198340988-198341010 GCCTGAACGGTGAGCTGGGCTGG + Intergenic
919748891 1:201024491-201024513 GGCTGGGCGGTGAAGTGGGTGGG + Intergenic
922724236 1:227915056-227915078 GTATGCACTGGGCAGTGGGCAGG + Intergenic
1062838678 10:652691-652713 GTCAGCACCGGGAAGTGGGATGG - Intronic
1063591520 10:7400093-7400115 GCCTGCACTGGGAAATGGGCAGG + Intronic
1066984670 10:42454503-42454525 GCCTGGGCTGTGAAGTGGGCAGG - Intergenic
1067167980 10:43880315-43880337 GTCTCCACGGAGACGTGGGAGGG + Intergenic
1067445119 10:46337084-46337106 GGCCGCACTGTGAGGTGGGCAGG + Intergenic
1067592252 10:47523644-47523666 GGCCGCACTGTGAGGTGGGCAGG - Intronic
1067639369 10:48031717-48031739 GGCCGCACTGTGAGGTGGGCAGG - Intergenic
1068485696 10:57655572-57655594 GTCTGGAAGGTGAAATGGGAAGG + Intergenic
1070760724 10:79022816-79022838 CTATGCACGGTGAACTGGGCAGG + Intergenic
1071969525 10:90888977-90888999 GGCTGCACTGTGAATTGGTCAGG + Intronic
1072742944 10:97921158-97921180 GTCTGGAGGGTGGAGTGGGGCGG + Intronic
1072769851 10:98128571-98128593 GTCTGCTCGGTGATTAGGGCAGG - Intergenic
1073456251 10:103638358-103638380 GCCTGTTCGGTGAGGTGGGCAGG - Intronic
1073458229 10:103650523-103650545 GTGTGGAGGGTGAAGTGGACAGG - Intronic
1074551863 10:114451142-114451164 GTGTGCACAGTGGAGTGGACAGG - Intronic
1076214771 10:128684611-128684633 GACTGCACAGTGAATGGGGCTGG + Intergenic
1076762357 10:132611861-132611883 GTGTGGGAGGTGAAGTGGGCAGG + Intronic
1076948049 10:133665207-133665229 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076949039 10:133668517-133668539 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
1076950023 10:133671816-133671838 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951007 10:133675115-133675137 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076951997 10:133678425-133678447 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076952986 10:133681735-133681757 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076953970 10:133685034-133685056 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076954954 10:133741386-133741408 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076955943 10:133744696-133744718 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076956933 10:133748006-133748028 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076957920 10:133751315-133751337 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076958905 10:133754614-133754636 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076959894 10:133757924-133757946 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1076960878 10:133761223-133761245 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1080405281 11:31973245-31973267 GTCTACACGCTGAAATGGGCTGG - Intronic
1081970506 11:47195087-47195109 GTCAGAAGGGTGGAGTGGGCAGG + Intergenic
1082095661 11:48127218-48127240 GTCGGGAGGGTGGAGTGGGCAGG + Intronic
1083276134 11:61598093-61598115 GTCTGCAGGGGGAAGTGGGGTGG - Intergenic
1083661390 11:64253007-64253029 GTCAGCACACTGAAGTGGGGAGG + Intronic
1090663954 11:128902503-128902525 GTCTGCATGGGGGAGGGGGCTGG + Exonic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1092011401 12:5115721-5115743 GTCTTCACGGTCTAGTGGGATGG - Intergenic
1092913323 12:13167332-13167354 GACTCCAGGGTGAAATGGGCAGG + Intergenic
1095952929 12:47791323-47791345 GTATTCACGCTGACGTGGGCTGG - Intronic
1102879844 12:116475910-116475932 GTCTGCTCTGTGAAATGGGCAGG + Intergenic
1104455726 12:128910798-128910820 GCTTGCACGATGAAGTGGGGAGG + Intronic
1104991069 12:132624204-132624226 GTTTGCATGGAGAAATGGGCTGG - Exonic
1107685039 13:42888358-42888380 GACTGCACGGTCAAGTGTGTGGG + Exonic
1108359625 13:49657320-49657342 GCCTTCACAGTGAAGTGAGCTGG - Intergenic
1114345984 14:21795663-21795685 GTCTACAGGCTGAAGTGGGAGGG + Intergenic
1117822934 14:59669882-59669904 GTCTGCATGATGAAGGGGCCAGG - Intronic
1122543224 14:102509258-102509280 CTCTGCCCGGTGACGTGGGGAGG - Intronic
1123048940 14:105531444-105531466 GTCTGCAGGATCAAGGGGGCTGG + Intergenic
1202848671 14_GL000225v1_random:1954-1976 GTCAGCCCGGTGGAGGGGGCTGG - Intergenic
1202852781 14_GL000225v1_random:31427-31449 GTCAGCCCGGTGGAGGGGGCAGG - Intergenic
1202864055 14_GL000225v1_random:104192-104214 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1202868022 14_GL000225v1_random:135690-135712 GTCTGCCTGGTGGAATGGGCGGG + Intergenic
1202922177 14_KI270723v1_random:36030-36052 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1202922756 14_KI270724v1_random:1584-1606 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1128786254 15:70399686-70399708 GTCTGCACTCTGGGGTGGGCTGG - Intergenic
1131542812 15:93288932-93288954 GTGGGGACGGTGCAGTGGGCGGG + Intergenic
1132739476 16:1404302-1404324 CTGTGCACAGTGAGGTGGGCGGG - Intronic
1134090851 16:11390982-11391004 GTCAGCACAGGGAAGGGGGCTGG - Intronic
1135970323 16:27067422-27067444 GTCTGCTTGGTGCTGTGGGCGGG - Intergenic
1137306311 16:47203920-47203942 GTCTGCAAGGTGAAGTGCTCTGG + Intronic
1140096955 16:71883798-71883820 GTCTGCACTGGGGAGAGGGCCGG - Intronic
1141491547 16:84377324-84377346 GCCTGGAAGGTGGAGTGGGCCGG + Intronic
1142559763 17:803047-803069 GTCTGCAGGGTGCAGGGTGCAGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142809225 17:2387451-2387473 TGCTGCACGGGGAGGTGGGCAGG + Exonic
1146807726 17:35878578-35878600 GTGGGCACGGGGCAGTGGGCGGG + Exonic
1147567880 17:41548697-41548719 GAATGCCCGGTGAGGTGGGCAGG - Intergenic
1150340557 17:64363283-64363305 TTCTGGATGGTGAAGTTGGCTGG + Exonic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1152210620 17:79001281-79001303 GTCTCCTGGGAGAAGTGGGCCGG - Intronic
1152965794 18:112312-112334 GTCAGCCCGGTGGAGGGGGCGGG + Intergenic
1153028340 18:690911-690933 GTCTGCATGGTGAAGCCTGCTGG - Intronic
1154357363 18:13632249-13632271 GCCTGCCAGGGGAAGTGGGCAGG - Intronic
1160937471 19:1603844-1603866 GTCTGCACGGTGGAGCTGACTGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165123987 19:33581153-33581175 ATCTGCAAAGTGAGGTGGGCTGG + Intergenic
925306423 2:2850506-2850528 CTCTGCAGGGGGCAGTGGGCAGG - Intergenic
925355715 2:3239652-3239674 GTCTGCACCGTGCTGAGGGCAGG - Intronic
925355734 2:3239726-3239748 GTCTGCACCGTGCTGAGGGCAGG - Intronic
929452303 2:42046321-42046343 GTCTGCAGGGTGTAGGGGGAAGG - Intergenic
932851993 2:75196621-75196643 GTCCGCACAGTGGATTGGGCAGG - Intronic
933994127 2:87655429-87655451 GTCTGCATGGTGAAGGGCCCAGG + Intergenic
936299738 2:111295484-111295506 GTCTGCATGGTGAAGGGCCCAGG - Intergenic
938033224 2:128013558-128013580 GTCTGCAGGGTGAAAAGTGCAGG - Intronic
1169037772 20:2467757-2467779 GTCTGCAAGGAGAAATGGACAGG + Exonic
1172700764 20:36852339-36852361 GGCTGCTCTGTGGAGTGGGCCGG + Intronic
1175604202 20:60299052-60299074 CTCTGCACTGTGAAGAGGTCAGG - Intergenic
1180958648 22:19752265-19752287 GTCTGCCCAGAGCAGTGGGCAGG + Intergenic
1180994774 22:19959965-19959987 GCCTGCAGAGTGGAGTGGGCCGG + Intronic
1183312651 22:37119216-37119238 GTCTGCACGGTAGAGAGGGAGGG - Intergenic
952674559 3:36012009-36012031 CTCTGCGCTGTGTAGTGGGCTGG - Intergenic
953889750 3:46743139-46743161 GTCTCCAGGGTGAAGGGGACAGG - Intronic
960244080 3:115380405-115380427 GGCTGCACAGGGAAGTGGGGTGG + Intergenic
961492654 3:127266177-127266199 GTCTGCTCGGTGAAGTGGGCAGG - Intergenic
965590630 3:170357626-170357648 GTCTCCGCAGTGACGTGGGCGGG + Intergenic
968087364 3:195879865-195879887 AACAGCACGATGAAGTGGGCGGG - Intronic
969313116 4:6365730-6365752 GTCCGCACGGCCAGGTGGGCTGG - Intronic
984742197 4:183175945-183175967 GTATGCAAGGTGAAGTGAGGTGG - Intronic
985451505 4:190066014-190066036 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985452495 4:190069307-190069329 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985453480 4:190072604-190072626 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985454470 4:190075897-190075919 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985455458 4:190079190-190079212 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985456443 4:190082484-190082506 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985457430 4:190085784-190085806 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
985458417 4:190089077-190089099 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985459406 4:190092377-190092399 GTCAGCCCGGTGGAGGGGGCGGG - Intronic
985463658 4:190175146-190175168 GTCAGCCCGGTGGAGGGGGCGGG - Exonic
985674473 5:1223893-1223915 GTCAGCAGGGTGAAAGGGGCTGG - Exonic
985777385 5:1851847-1851869 GTCTGCACGGTGGCGCGGGGTGG + Intergenic
985837167 5:2280083-2280105 GTCTGCAATGTGAAGAGGACAGG - Intergenic
987027023 5:13937620-13937642 CTTTGCACGGGGAAGTGGGTAGG + Intronic
990734091 5:58841099-58841121 GTCTGCAGGGGGCAGGGGGCAGG + Intronic
991194154 5:63912193-63912215 GTCTGCATGGTGGGCTGGGCAGG - Intergenic
992299561 5:75364316-75364338 GTCTAGACAGTGAAATGGGCAGG - Intergenic
994966689 5:106681548-106681570 GCCTGGGCAGTGAAGTGGGCAGG - Intergenic
1000494344 5:161960890-161960912 GTCTGGAGAGTGAAGTGGGGTGG - Intergenic
1001417254 5:171554836-171554858 TTCTCCCCGGTGAAGTGGGAAGG - Intergenic
1002590129 5:180285395-180285417 GTCAGCAAGGTGAAATGTGCAGG - Intronic
1004370636 6:15049305-15049327 GCCTGCACTGTGATGAGGGCTGG + Intergenic
1017046642 6:150352771-150352793 GTTTTCTCGGTGCAGTGGGCAGG + Intergenic
1019417923 7:935677-935699 GTCTGCACCGGGCAGAGGGCGGG - Intronic
1020122525 7:5513230-5513252 GGCTCCAGGGAGAAGTGGGCTGG + Intronic
1022817685 7:33929116-33929138 GTTTGCACTGTGAGCTGGGCCGG + Intronic
1023109746 7:36797248-36797270 GTGTGCTTGGTGAAGGGGGCAGG - Intergenic
1026598283 7:71752503-71752525 GTCTGCAAGGTGAGCTGGGCTGG + Intergenic
1026941789 7:74291283-74291305 GCCTGCACGGTGCTGAGGGCTGG - Intronic
1032076284 7:128837669-128837691 GTCTGCACGGTGAAGTGGGCAGG - Exonic
1032077597 7:128843425-128843447 GTCAGCACCGTGAAGTGGGTGGG - Exonic
1032781486 7:135168256-135168278 GGCTGCACTGTGAAGTGGGCGGG - Intronic
1036101308 8:5788788-5788810 GTCTCCACAAGGAAGTGGGCAGG + Intergenic
1036445809 8:8821037-8821059 GTCAGCACAGGGAAGTGGGGAGG + Intronic
1040288931 8:46114463-46114485 GGCTGCAAGGTGGGGTGGGCGGG - Intergenic
1040290422 8:46121373-46121395 GGCTGCACGGTGGCCTGGGCGGG - Intergenic
1040291703 8:46128863-46128885 GGCTGTAGGGTGACGTGGGCGGG - Intergenic
1040292160 8:46131073-46131095 GGCCGCAGGGTGACGTGGGCGGG - Intergenic
1040295023 8:46144634-46144656 GGCTGCAGGGTGGCGTGGGCGGG - Intergenic
1040295362 8:46146218-46146240 GTCTGCAAGGTGGCGTGGGCGGG - Intergenic
1040299382 8:46180092-46180114 GGCCGCAGGGTGGAGTGGGCGGG - Intergenic
1040301822 8:46191942-46191964 GGCTGCAGGGTGGCGTGGGCAGG + Intergenic
1040302911 8:46197207-46197229 GGCAGCACAGTGGAGTGGGCGGG + Intergenic
1040304773 8:46206328-46206350 GCCTGCAGGGTGGCGTGGGCAGG + Intergenic
1040324247 8:46333667-46333689 GAAGGCAGGGTGAAGTGGGCAGG + Intergenic
1040324383 8:46334318-46334340 GGCTGCAAGGTGGTGTGGGCAGG + Intergenic
1040335756 8:46415115-46415137 GACTGCAGGGTGGCGTGGGCGGG + Intergenic
1040337353 8:46422822-46422844 GGCTGCAGGGTGGTGTGGGCTGG + Intergenic
1041251773 8:55941175-55941197 GTGTGCAAGGTGGAGTGGGGTGG - Intronic
1046395394 8:113633344-113633366 GTCTGCAAGGAGACGTGGCCAGG - Intergenic
1048170993 8:132106190-132106212 ATCTGGAAGGTGAATTGGGCGGG + Intronic
1048867635 8:138772382-138772404 GTCATCACGGTGAAGAGGACAGG + Intronic
1049527145 8:143133100-143133122 GTCTGAAGAGTGGAGTGGGCTGG - Intergenic
1049742658 8:144248572-144248594 TTCTGACCAGTGAAGTGGGCTGG - Intronic
1051169224 9:14302052-14302074 GTCTGCACTGTGAAATGCTCTGG - Intronic
1058504889 9:105656818-105656840 GGCTGCACGGTGCAGGGGTCGGG + Intergenic
1058601392 9:106674544-106674566 TTCTGCCCTGTGAAGTGTGCAGG - Intergenic
1058745831 9:107989755-107989777 GTTTGCATGGTGCAATGGGCAGG + Intergenic
1059434917 9:114270454-114270476 CTCTGCAGGGTGACGTGGGGTGG - Intronic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062609478 9:137367569-137367591 GCCTCCACCGTGCAGTGGGCTGG - Intronic
1203736749 Un_GL000216v2:144577-144599 GTCTGCCTGGTGGAATGGGCGGG - Intergenic
1203740264 Un_GL000216v2:171824-171846 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic
1185811764 X:3117010-3117032 GTCTGCACTGTAAAGGGAGCAGG + Intergenic
1188635455 X:32425219-32425241 CTCTGCACGGTAAAGGGGGTTGG - Intronic
1190691767 X:52918580-52918602 GTCTCCATGGTGATGTGGGAAGG + Intergenic
1190694216 X:52937212-52937234 GTCTCCATGGTGATGTGGGAAGG - Intronic
1193170638 X:78331884-78331906 GTATGGATGGGGAAGTGGGCTGG + Intergenic
1201179913 Y:11333693-11333715 GTCAGCCCGGTGGAGGGGGCGGG - Intergenic