ID: 1032079183

View in Genome Browser
Species Human (GRCh38)
Location 7:128850131-128850153
Sequence CTCTCTACTCCTCTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 987}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032079175_1032079183 7 Left 1032079175 7:128850101-128850123 CCTCCTCCTCCTCCCCTTCCTTC 0: 2
1: 93
2: 1196
3: 6631
4: 17223
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079174_1032079183 18 Left 1032079174 7:128850090-128850112 CCAGGCGATGTCCTCCTCCTCCT 0: 1
1: 0
2: 6
3: 54
4: 407
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079179_1032079183 -5 Left 1032079179 7:128850113-128850135 CCCCTTCCTTCATTTCTTCTCTC 0: 1
1: 0
2: 38
3: 366
4: 2781
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079172_1032079183 22 Left 1032079172 7:128850086-128850108 CCCACCAGGCGATGTCCTCCTCC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079181_1032079183 -7 Left 1032079181 7:128850115-128850137 CCTTCCTTCATTTCTTCTCTCTA 0: 1
1: 0
2: 42
3: 737
4: 5491
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079180_1032079183 -6 Left 1032079180 7:128850114-128850136 CCCTTCCTTCATTTCTTCTCTCT 0: 1
1: 6
2: 107
3: 880
4: 5538
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079177_1032079183 1 Left 1032079177 7:128850107-128850129 CCTCCTCCCCTTCCTTCATTTCT 0: 1
1: 4
2: 68
3: 922
4: 6736
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079173_1032079183 21 Left 1032079173 7:128850087-128850109 CCACCAGGCGATGTCCTCCTCCT 0: 1
1: 0
2: 0
3: 18
4: 205
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079178_1032079183 -2 Left 1032079178 7:128850110-128850132 CCTCCCCTTCCTTCATTTCTTCT 0: 1
1: 6
2: 86
3: 1033
4: 6507
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079171_1032079183 25 Left 1032079171 7:128850083-128850105 CCTCCCACCAGGCGATGTCCTCC 0: 1
1: 1
2: 0
3: 14
4: 213
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987
1032079176_1032079183 4 Left 1032079176 7:128850104-128850126 CCTCCTCCTCCCCTTCCTTCATT 0: 1
1: 4
2: 62
3: 649
4: 4630
Right 1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG 0: 1
1: 0
2: 2
3: 41
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032079183 Original CRISPR CTCTCTACTCCTCTGCAGCC AGG Intronic
900122671 1:1055521-1055543 GCCTCTGCTCCTCAGCAGCCTGG - Exonic
900218220 1:1493483-1493505 GTCTCTACTGCACTCCAGCCTGG - Intronic
900227257 1:1539231-1539253 CCCTCAGCTCCTCTCCAGCCCGG + Intronic
900251764 1:1674571-1674593 CTCGCCACTGCACTGCAGCCTGG + Intronic
900262172 1:1737427-1737449 CTCGCCACTGCACTGCAGCCTGG + Intronic
900281880 1:1875109-1875131 CTCTCACCTGCTGTGCAGCCCGG + Intronic
900386780 1:2414279-2414301 CACTCTTCTCATCTGCACCCTGG + Intergenic
900457953 1:2786441-2786463 CTACCTACTCCTCTGCACCAAGG - Intronic
900494065 1:2968471-2968493 CTCTGTGCCCCTCTGCAGCCTGG + Intergenic
901293357 1:8141599-8141621 CTCACCACTGCACTGCAGCCTGG + Intergenic
901551006 1:9996265-9996287 CTCTCCACTGCACTCCAGCCTGG + Intergenic
901611274 1:10500328-10500350 CGCGCTACTGCCCTGCAGCCTGG + Intronic
901728980 1:11264395-11264417 ATCTCCACTGCACTGCAGCCTGG + Intergenic
901853603 1:12030729-12030751 CTCGCCACTGCACTGCAGCCTGG + Intronic
901980254 1:13028753-13028775 CTCACCACTGCTCTCCAGCCTGG - Intronic
902001832 1:13200178-13200200 CTCACCACTGCTCTCCAGCCTGG + Intergenic
902021059 1:13345903-13345925 CTCACCACTGCTCTCCAGCCTGG + Intronic
902217519 1:14944028-14944050 CTCACTACTGCACTCCAGCCTGG + Intronic
902245393 1:15117480-15117502 TTCTCCCCTCCTCTGCAGCCTGG - Exonic
902343095 1:15797411-15797433 CGCTCTACTGCACTCCAGCCTGG - Intergenic
902519873 1:17010119-17010141 CTCTCCACTGCACTCCAGCCTGG - Intronic
902524830 1:17049701-17049723 CTCGCCACTCCACTCCAGCCTGG - Intronic
902717872 1:18284962-18284984 ATCCCAACTCCTCTCCAGCCAGG - Intronic
902755355 1:18545781-18545803 CCCTCTCCTCCTCTGTACCCTGG + Intergenic
903131634 1:21283312-21283334 CTCTCCACTGCACTCCAGCCTGG - Intronic
903481188 1:23654577-23654599 CTCTCTCCTCCTCCTCCGCCAGG + Intergenic
903505803 1:23835006-23835028 CGCTCCACTGCACTGCAGCCTGG - Intronic
904138116 1:28329700-28329722 CTCCCCACTGCACTGCAGCCTGG + Intronic
904165893 1:28554798-28554820 CGCTCCACTCCACTCCAGCCTGG + Intronic
904919967 1:33999433-33999455 CTCGCTACTGCACTTCAGCCTGG - Intronic
905673936 1:39812096-39812118 CTCTCCACTGCACTCCAGCCTGG - Intergenic
905683956 1:39895769-39895791 CTCTCTACCCTTCTGGAGCATGG - Exonic
905714791 1:40139625-40139647 CTCGCCACTACACTGCAGCCTGG - Intergenic
906016568 1:42587039-42587061 CGCACTACTGCACTGCAGCCTGG - Intronic
906234068 1:44192925-44192947 CACACTACTGCGCTGCAGCCTGG + Intergenic
906304292 1:44706749-44706771 CTGGCAACTCCTCTCCAGCCAGG - Intronic
906411444 1:45582712-45582734 CTCGCCACTGCACTGCAGCCTGG - Intergenic
906724190 1:48031896-48031918 CTCACCACTCCACTCCAGCCTGG - Intergenic
907377017 1:54052715-54052737 TGCTCGACTCCCCTGCAGCCCGG + Intronic
907763241 1:57382689-57382711 CTCTCTGGTTCTTTGCAGCCGGG + Intronic
907790627 1:57659931-57659953 CACCCTACTGCTCTTCAGCCTGG + Intronic
907883731 1:58574828-58574850 CACTCCACTGCCCTGCAGCCTGG + Intergenic
908194792 1:61738299-61738321 CTCACCACTGCTCTCCAGCCTGG + Intergenic
908744299 1:67360750-67360772 CACTCTACTGCACTCCAGCCTGG + Intronic
908825691 1:68130935-68130957 CGCTCCACTCCACTCCAGCCTGG - Intronic
908903967 1:68986478-68986500 ATCTCAACTCCTCTCCAGCAAGG + Intergenic
909011206 1:70337535-70337557 CACTCCACTGCACTGCAGCCTGG + Intronic
909071085 1:70994499-70994521 CGCACTACTGCACTGCAGCCTGG - Intronic
909593147 1:77374774-77374796 CTCACCACTACTCTCCAGCCTGG + Intronic
909611145 1:77552994-77553016 CTCACTACTGCACTCCAGCCTGG + Intronic
909713640 1:78680602-78680624 CTTTCTGATCCTCTGTAGCCTGG - Intergenic
909753631 1:79195329-79195351 CTGCCTACTCCTCTGCATCCAGG + Intergenic
910223646 1:84915139-84915161 CTCTCCACTGCACTCCAGCCTGG - Intergenic
910233575 1:85011435-85011457 CACACTACTGCACTGCAGCCTGG - Intronic
911054036 1:93695671-93695693 CTCTGTAATTCTCTGCAGTCAGG + Intronic
911577504 1:99596073-99596095 CGCTCTACTGCCCTCCAGCCTGG - Intergenic
912455611 1:109794829-109794851 CTGCCTCCTCATCTGCAGCCTGG - Intergenic
913341176 1:117759313-117759335 GTCCCTACCCCTCTGAAGCCTGG - Intergenic
914763623 1:150618926-150618948 CTCACTACTGCACTCCAGCCTGG + Intronic
914888493 1:151602167-151602189 CTCACCACTCCACTCCAGCCTGG + Intergenic
915025785 1:152828158-152828180 CTCTCTACTTTCCTGCTGCCTGG + Intergenic
915150853 1:153830188-153830210 CTCACCACTCCACTCCAGCCTGG - Intronic
915161941 1:153926840-153926862 CACTCCACTCCACTCCAGCCTGG - Intergenic
915173594 1:153996246-153996268 CTCTCCACTGCACTCCAGCCTGG + Intronic
915175192 1:154008630-154008652 CTCACTACACCTCTGCCTCCCGG - Intronic
915181536 1:154065375-154065397 TGCTCTACTGCTCTCCAGCCTGG + Intronic
915220704 1:154372281-154372303 CTCTCCACTGCACTCCAGCCTGG + Intergenic
915281112 1:154822760-154822782 CTCTCTGCTCCTGTGCTTCCTGG - Intronic
915382073 1:155451151-155451173 CTCTCCATTGCACTGCAGCCTGG + Intronic
915800287 1:158784060-158784082 CTCGCCACTGCACTGCAGCCTGG + Intergenic
915909777 1:159907366-159907388 CTCTCCACCCCTCTCCAACCAGG - Intergenic
916398592 1:164420261-164420283 CTCTCTGAACCTCTTCAGCCTGG + Intergenic
916662872 1:166938115-166938137 CTCTCTAGGCCACTCCAGCCAGG - Intronic
916747226 1:167693896-167693918 CTCTATCCTCCTCTGCTACCTGG - Intronic
916952976 1:169799901-169799923 CGCACTACTGCTCTCCAGCCTGG - Intronic
917234188 1:172872947-172872969 TTCATTACTACTCTGCAGCCTGG - Intergenic
917335540 1:173921034-173921056 CTCTTTAGTCTTCTGCAGCTTGG + Intergenic
917371055 1:174294960-174294982 CACACTACTGCACTGCAGCCTGG - Intronic
917808837 1:178637920-178637942 CTCACTACTGCACTCCAGCCTGG + Intergenic
917915353 1:179695446-179695468 ATCTCAACTCCTCTCCAGCAAGG + Intergenic
918084158 1:181231074-181231096 CTCTCTAGTTCTCTGCAGTCAGG + Intergenic
918306836 1:183254480-183254502 CTCACTACTGCACTCCAGCCTGG - Intronic
918634393 1:186757319-186757341 CACACTACTGCTCTCCAGCCTGG + Intergenic
918740746 1:188127994-188128016 CACTCTCCTCCATTGCAGCCTGG + Intergenic
919236880 1:194857600-194857622 CTCTCCACTGCACTCCAGCCTGG - Intergenic
919834575 1:201564920-201564942 CTCGCTGCTTCTCTGCAGCTAGG + Intergenic
919849777 1:201664848-201664870 CTCCCTTTTCCCCTGCAGCCAGG + Intronic
920819396 1:209366100-209366122 CTCACTACTGCACTTCAGCCTGG + Intergenic
920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG + Intronic
921660639 1:217797291-217797313 CACACTACTGCACTGCAGCCTGG - Intronic
921971388 1:221153106-221153128 CTCTGTGCTCCTCGGCACCCTGG - Intergenic
921979678 1:221242410-221242432 CGCGCTACTCCACTCCAGCCTGG - Intergenic
923328432 1:232900729-232900751 CTCTCCACTCCCCTCCAGCCTGG + Intergenic
923396924 1:233575038-233575060 CGCTCCACTGCACTGCAGCCCGG - Intergenic
923451998 1:234126732-234126754 TTCTGTACTCCACTCCAGCCTGG - Intronic
923738988 1:236638314-236638336 CTCGCCACTGCTCTCCAGCCTGG + Intergenic
924187477 1:241509730-241509752 CACTCTACTGCACTCCAGCCTGG + Intronic
924509257 1:244715089-244715111 CGCTCTACTGCACTCCAGCCTGG + Intergenic
924728029 1:246688086-246688108 CTCACCACTGCTCTTCAGCCTGG - Intergenic
924732090 1:246721586-246721608 CACACTACTGCACTGCAGCCTGG - Intergenic
924909950 1:248499037-248499059 CTCACCACTGCACTGCAGCCTGG + Intergenic
924914153 1:248549022-248549044 CTCACCACTGCACTGCAGCCTGG - Intergenic
1062817702 10:512873-512895 CACTGTACTCCACTCCAGCCTGG + Intronic
1063086716 10:2825958-2825980 TTCTCTCCTGCTCTGCTGCCTGG + Intergenic
1063427717 10:5962765-5962787 CTGTCTACTCCTTTGCCCCCGGG - Intronic
1063563406 10:7150157-7150179 CTCACTACTGCACTACAGCCTGG - Intergenic
1063683689 10:8214882-8214904 GTCACTATTCCACTGCAGCCTGG + Intergenic
1063919244 10:10915447-10915469 CCTTCTACTGCTCTCCAGCCTGG - Intergenic
1064625892 10:17260952-17260974 CACTCCACTGCACTGCAGCCTGG - Intergenic
1065308526 10:24391660-24391682 CTCTTTCTTCCTTTGCAGCCAGG + Intronic
1065352451 10:24807658-24807680 CTCCCTACTGCACTCCAGCCTGG + Intergenic
1065435340 10:25699643-25699665 CTCTCTGCCCTTCTCCAGCCAGG + Intergenic
1065712678 10:28532969-28532991 CTTTCTCCTCCTCTGAGGCCTGG - Intronic
1065951417 10:30654999-30655021 CTCGCTACTGCACTCCAGCCTGG + Intergenic
1067064724 10:43097299-43097321 CTACCCACTCTTCTGCAGCCTGG + Intronic
1067116605 10:43440090-43440112 CTCTCCACTGCACTCCAGCCTGG - Intronic
1068241303 10:54304537-54304559 CTATCTGCTGCTCTGCTGCCAGG - Intronic
1068454346 10:57235837-57235859 CTCACTACTGCCCTTCAGCCTGG - Intergenic
1068890015 10:62139094-62139116 CATACTACTCCACTGCAGCCTGG - Intergenic
1069535389 10:69249093-69249115 CTCTGTTCTCTTCTGCAGCTTGG + Intronic
1069705666 10:70457911-70457933 CTCGCTACTGCTCTCCAGCGTGG + Intergenic
1069926162 10:71852063-71852085 CGCACTACTGCACTGCAGCCTGG + Intergenic
1069937945 10:71931716-71931738 CACTCCACTCCACTCCAGCCTGG + Intergenic
1069967202 10:72129935-72129957 CACTCTACTACACTCCAGCCTGG + Intronic
1070072164 10:73100240-73100262 CTCACTACTGCACTCCAGCCTGG + Intergenic
1070104422 10:73417670-73417692 CTCACTACTGCACTCCAGCCTGG + Intergenic
1070237089 10:74639790-74639812 CTCGCTACTGCACTCCAGCCTGG + Intronic
1070547802 10:77466127-77466149 CTCTCTGCCCCTCTGAAGCCTGG + Intronic
1070769951 10:79076433-79076455 CTCCCAGATCCTCTGCAGCCAGG + Intronic
1070856507 10:79611564-79611586 CTTCCTCCTCCTCAGCAGCCTGG + Exonic
1071294815 10:84211822-84211844 CTCTCCACTTCTCTTCACCCAGG - Intronic
1071531227 10:86391610-86391632 CTCACTCCTCCTCCTCAGCCTGG - Intergenic
1071787603 10:88919877-88919899 CACTCTACTGCACTCCAGCCTGG - Intronic
1072193084 10:93091812-93091834 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1072860316 10:98997154-98997176 CGCTCCACTGCACTGCAGCCTGG - Intronic
1072979666 10:100089388-100089410 CACGCTACTGCACTGCAGCCTGG - Intergenic
1073016618 10:100405182-100405204 CACTCCACTCCACTCCAGCCTGG - Intergenic
1073330188 10:102665362-102665384 CTCACTACTGCACTCCAGCCTGG + Intergenic
1073510338 10:104038799-104038821 CTCTCAACTCCCCAGCACCCTGG + Intronic
1073906788 10:108291367-108291389 CACTCCACTGCTCTCCAGCCTGG - Intergenic
1074082634 10:110179823-110179845 TTCCCTACTCCACTCCAGCCTGG - Intergenic
1074120966 10:110494407-110494429 CTCTCTCATCCTCTGCAGTGTGG - Intergenic
1074320354 10:112396291-112396313 CTCTTGATTCCTCTGCAGCAGGG + Intronic
1074366035 10:112858406-112858428 CGCTCCACTGCTCTTCAGCCTGG - Intergenic
1074544374 10:114391261-114391283 CTCACTACTGCACTCCAGCCTGG - Intronic
1074609787 10:115010446-115010468 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1074914407 10:117941597-117941619 CTCTCTGATTTTCTGCAGCCAGG + Intergenic
1075059467 10:119245232-119245254 CGCACTACTGCACTGCAGCCTGG + Intronic
1075227705 10:120644640-120644662 CTTTCTACTCCTTTCCAGACAGG - Intergenic
1075253910 10:120908792-120908814 CCCTGTACTCCTCTTCATCCTGG - Exonic
1075313973 10:121437551-121437573 CTCTCTCCGGCCCTGCAGCCAGG - Intergenic
1075467856 10:122664903-122664925 CTGTCAACTCCTCTCCAGCATGG + Intergenic
1075958382 10:126545185-126545207 CTCTCTCATCCTCCGGAGCCAGG + Intronic
1076396014 10:130137776-130137798 CGCTCCACTACACTGCAGCCTGG - Intronic
1076450715 10:130555265-130555287 CTCTCTCCTCCTTTCCAGTCGGG - Intergenic
1076871255 10:133196167-133196189 CTCTCTGCTCCCCTCCAGCAGGG - Intronic
1076905668 10:133359558-133359580 CACTCCACTGCTCTCCAGCCTGG + Intergenic
1077265016 11:1644363-1644385 CTCTCTCCGCCTCGGCTGCCAGG + Intergenic
1077590972 11:3490804-3490826 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1077704789 11:4474726-4474748 CTCTCTAATCCTATGTACCCTGG + Intergenic
1078196033 11:9137911-9137933 CTCTCACCCCCTCTGCAGGCAGG + Intronic
1078300440 11:10125062-10125084 CTCGCTACTGCACTCCAGCCTGG + Intronic
1078337257 11:10474198-10474220 TTATCTACTCCTCTACACCCAGG + Intronic
1078854090 11:15192152-15192174 CTCTGGGCTCCTCTTCAGCCTGG - Intronic
1079231369 11:18651764-18651786 CTCACTACTACACTCCAGCCTGG - Intergenic
1080533556 11:33199806-33199828 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1080644249 11:34176596-34176618 CGCACCACTCCCCTGCAGCCTGG + Intronic
1080855935 11:36111642-36111664 CGCTCTACTGCACTCCAGCCTGG - Intronic
1081013904 11:37851590-37851612 CTCTCCACTGCCCTGCACCCTGG + Intergenic
1081419679 11:42860046-42860068 CGCACTACTGCTCTCCAGCCTGG + Intergenic
1081593781 11:44445481-44445503 CACACTACTGCACTGCAGCCTGG + Intergenic
1082926452 11:58552372-58552394 CTCTCTACTCCTTTCCAGCTGGG + Intronic
1083299427 11:61732595-61732617 CTCTCTGGTGCTCTGCAGACAGG + Intronic
1083598428 11:63931508-63931530 CTCGCCACTGCACTGCAGCCTGG - Intergenic
1083603656 11:63963790-63963812 CTTGCTACTGCACTGCAGCCTGG + Intergenic
1083717169 11:64584094-64584116 CTCTCTCCCCCTTTGCTGCCTGG + Intergenic
1083773796 11:64883249-64883271 CCCTTTGCTGCTCTGCAGCCTGG + Intronic
1083914683 11:65733707-65733729 CTCACTACTGCACTCCAGCCTGG + Intergenic
1083927394 11:65816439-65816461 CACGCCACTCCACTGCAGCCTGG + Intergenic
1083947723 11:65934018-65934040 CACTCTACTGCACTCCAGCCTGG + Intergenic
1084007755 11:66332272-66332294 CAAGCTACTCCTCTGCTGCCCGG + Exonic
1084649881 11:70482930-70482952 CCCTCTACTCGTCTTCAGGCTGG - Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1085687939 11:78641103-78641125 CACACTACTGCACTGCAGCCTGG + Intergenic
1085696151 11:78706452-78706474 CTCTCTACTCCGCTGCCCCATGG - Intronic
1085739148 11:79064455-79064477 CTCTCTGCTCCCCTGCACACAGG + Intronic
1087169861 11:95039346-95039368 CACTCAACTGCTATGCAGCCGGG - Intergenic
1087467488 11:98527158-98527180 CACACTACTGCTCTCCAGCCTGG - Intergenic
1087782319 11:102314273-102314295 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1088272460 11:108048708-108048730 CGCGCTACTGCACTGCAGCCTGG - Intronic
1088423187 11:109670941-109670963 CTCACTACTGCACTCCAGCCTGG + Intergenic
1089024075 11:115249946-115249968 CGCACTACTGCACTGCAGCCTGG - Intronic
1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG + Intergenic
1089312812 11:117571217-117571239 CTCTCAAATCCTCTGCTCCCAGG - Intronic
1089533503 11:119147351-119147373 CTCACCACTGCTCTCCAGCCTGG + Intergenic
1089728993 11:120508824-120508846 CACTGTACTCCACTCCAGCCTGG + Intergenic
1089771951 11:120809302-120809324 CTTCCAACTCCTCTGCTGCCTGG + Intronic
1089854791 11:121533773-121533795 CTCTCTCCTTCTCTGAGGCCAGG - Intronic
1090065888 11:123503128-123503150 CTGTGAAGTCCTCTGCAGCCTGG + Intergenic
1090593475 11:128295802-128295824 CTCACTCCTCATCTTCAGCCAGG - Intergenic
1091170920 11:133518983-133519005 CTCTCTCCTCCTCTTCAACACGG + Intronic
1091220851 11:133929360-133929382 CTCTGGATTCCTCTGGAGCCTGG - Intronic
1091475480 12:768175-768197 CTCTCTACTGCACTACAGCCTGG - Intronic
1091738436 12:2942328-2942350 CACACTACTGCACTGCAGCCTGG - Intergenic
1091817605 12:3451907-3451929 TTCTCTACTCCTCAACTGCCAGG - Intronic
1092248277 12:6875999-6876021 CACGCTACTCCACTCCAGCCTGG - Intronic
1092362981 12:7853554-7853576 CTCACCACTACACTGCAGCCTGG + Intronic
1092717288 12:11403945-11403967 CGCGCCACTGCTCTGCAGCCTGG - Intronic
1092727427 12:11499549-11499571 CTCTGTTTTCCTCTGCAGCCAGG + Intronic
1092828218 12:12417697-12417719 CTCGCTACTGCACTGCAGCCTGG - Intronic
1092871131 12:12806673-12806695 CTCGCTACTGCACTCCAGCCTGG + Intronic
1093260846 12:16936012-16936034 CACTCTACTGCACTCCAGCCTGG - Intergenic
1093405738 12:18801815-18801837 CTCACCACTGCACTGCAGCCTGG - Intergenic
1093470428 12:19495583-19495605 CTCACTACTGCACTCCAGCCTGG - Intronic
1093782756 12:23155833-23155855 CACACTACTTCTCTCCAGCCTGG - Intergenic
1094525758 12:31229619-31229641 CCCTCCACTGCTCTCCAGCCAGG + Intergenic
1095143200 12:38692243-38692265 CTCACTACTGCACTCCAGCCTGG + Intronic
1095462840 12:42460526-42460548 CTCTGCACTCCTGTGCAGCATGG + Exonic
1096114480 12:49047454-49047476 CACTGTACTCCACTCCAGCCTGG - Intronic
1096423240 12:51478393-51478415 CACTCTACTGCACTCCAGCCTGG + Intronic
1096452342 12:51754662-51754684 CTCTCTAATTTTCTTCAGCCTGG + Intronic
1096777738 12:53974290-53974312 CTCCCCACTCCTCGGCAGCCCGG - Intronic
1096827198 12:54288856-54288878 CGCGCTACTGCTCTCCAGCCTGG + Intergenic
1096989401 12:55787186-55787208 CATGCTACTGCTCTGCAGCCTGG + Intronic
1097078121 12:56410205-56410227 CACACTACTGCACTGCAGCCTGG + Intergenic
1097254291 12:57660595-57660617 CGCTCCACTGCACTGCAGCCTGG + Intergenic
1097580892 12:61455012-61455034 CACTCTCCTGCTGTGCAGCCTGG + Intergenic
1097711350 12:62920966-62920988 CACTCTACTCCACTCCAGCCTGG - Intronic
1098470656 12:70839782-70839804 TTCTCTCCTCCTGTGGAGCCAGG + Intronic
1099548285 12:84011952-84011974 CACTCTACTCCACTCCAGCCTGG - Intergenic
1099634871 12:85200861-85200883 CGCTCCACTGCACTGCAGCCTGG - Intronic
1100253426 12:92856813-92856835 CTCACCACTGCTCTCCAGCCTGG - Intronic
1100361294 12:93882078-93882100 CTCGCCACTGCACTGCAGCCTGG + Intronic
1100500208 12:95166657-95166679 CTCACTACTGCACTCCAGCCTGG + Intronic
1100864965 12:98847637-98847659 CTCTCCACTGCACTCCAGCCTGG - Intronic
1101476065 12:105049578-105049600 CTCTCTTCTACTCTTCTGCCAGG + Intronic
1101897000 12:108764456-108764478 CTCACCACTGCACTGCAGCCTGG + Intergenic
1102103533 12:110300234-110300256 CACACTACTCCACTGTAGCCTGG - Intronic
1102285052 12:111649194-111649216 CTCACCACTGCACTGCAGCCTGG - Intronic
1102393952 12:112572682-112572704 CGCTCTACTGCACTCCAGCCTGG - Intronic
1102739599 12:115195454-115195476 CTCACTACAACTCTGCAGGCTGG + Intergenic
1102956266 12:117061076-117061098 CTGTCTACTCCTTTGCAAACAGG + Intronic
1103353115 12:120299175-120299197 CTCTCCACTACACTCCAGCCTGG + Intergenic
1103398218 12:120624394-120624416 CGCGCTACTGCACTGCAGCCTGG - Intergenic
1103497079 12:121371243-121371265 CGCTCTACTGCACTCCAGCCTGG - Intronic
1103626440 12:122223842-122223864 CTCACCACTGCTCTCCAGCCTGG - Intronic
1104031530 12:125068413-125068435 CTCGCCACTGCACTGCAGCCTGG + Intronic
1104220059 12:126774120-126774142 GTGTCTACTCCTCTGCCTCCGGG + Intergenic
1104359343 12:128117338-128117360 CTCACTACTGCACTCCAGCCTGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105353876 13:19640060-19640082 CGCGCCACTACTCTGCAGCCTGG + Intronic
1106250847 13:27980492-27980514 CTTTCCCCTCCTCCGCAGCCCGG - Intronic
1106253758 13:28003179-28003201 CTCACCACTCCACTCCAGCCTGG + Intergenic
1106474576 13:30087517-30087539 CTCGCCACTGCACTGCAGCCTGG - Intergenic
1106598142 13:31164259-31164281 CACTCCACTGCACTGCAGCCTGG + Intergenic
1106854274 13:33831140-33831162 CTCACTCCTGCTGTGCAGCCCGG + Intronic
1107145924 13:37060189-37060211 TTCTCCACTCCACTCCAGCCTGG - Intergenic
1107867256 13:44714868-44714890 CACTCTACTACACTCCAGCCTGG - Intergenic
1109432429 13:62252890-62252912 CACTCTACTGCACTCCAGCCTGG - Intergenic
1110913245 13:80990153-80990175 CTCACTACTGCACTCCAGCCTGG - Intergenic
1111324730 13:86678972-86678994 CACTCTACTGCACTCCAGCCTGG - Intergenic
1112008647 13:95275704-95275726 CTCTGTACTGCACTCCAGCCTGG + Intronic
1112389319 13:98968574-98968596 CACTCCACTGCACTGCAGCCTGG + Intronic
1112451957 13:99520610-99520632 CTCACCACTACACTGCAGCCTGG - Intronic
1112921081 13:104613455-104613477 CACACTACTGCACTGCAGCCTGG + Intergenic
1113478755 13:110605055-110605077 CTCACCACTGCACTGCAGCCTGG + Intergenic
1113727941 13:112618976-112618998 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1113918919 13:113894637-113894659 CACTCTACTGCACTCCAGCCTGG - Intergenic
1113981389 13:114280006-114280028 CTCTGCACACCTCTGAAGCCAGG - Intergenic
1114304866 14:21413436-21413458 CGCTCTACTGCACTCCAGCCTGG - Intronic
1114364229 14:22009955-22009977 CTCCCTCTTCCTCTGCTGCCCGG - Intergenic
1115499097 14:34033616-34033638 CACTCCACTCAACTGCAGCCTGG + Intronic
1115674591 14:35657136-35657158 CTCTCTGCTCCTGTGCAGACTGG + Intronic
1116325736 14:43532860-43532882 CTCTCAGCGCCTCTTCAGCCTGG + Intergenic
1116822477 14:49638994-49639016 CTCTTGACTCCTGTGCAGCCTGG + Intergenic
1117016647 14:51525310-51525332 CTCGCTACTGCACTCCAGCCCGG - Intronic
1117589664 14:57254389-57254411 CACTCTACTGCACTCCAGCCTGG + Intronic
1118003206 14:61542622-61542644 CTCCCTGTTCCTCTACAGCCAGG - Intronic
1118179745 14:63480487-63480509 CACTCTACTGCACTTCAGCCTGG - Intronic
1118747661 14:68785715-68785737 CTCTGAGCTCCTCTGCAGCTAGG - Intergenic
1118784119 14:69031567-69031589 CTCGCCACTGCTCTCCAGCCTGG - Intergenic
1118852906 14:69598334-69598356 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1118934138 14:70270867-70270889 CACTGTACTCCACTCCAGCCTGG - Intergenic
1119213986 14:72854321-72854343 CTCTCTACTCTACTCCAGCCTGG + Intronic
1119584276 14:75817879-75817901 CTCACTACTGCACTCCAGCCTGG - Intronic
1119658831 14:76436417-76436439 CTCTGGAGCCCTCTGCAGCCTGG + Intronic
1120405980 14:84093814-84093836 CTCACCACTGCACTGCAGCCTGG - Intergenic
1120801220 14:88690977-88690999 CTGTTTACTTCTCTGCACCCAGG + Intronic
1121235249 14:92387218-92387240 CTCGCCACTGCTCTCCAGCCTGG - Intronic
1121464186 14:94103594-94103616 CTCTGTGATCCTCTGTAGCCAGG - Intronic
1121564026 14:94895259-94895281 CTCTCTGCTCCTCTGTTTCCCGG + Intergenic
1122490630 14:102113410-102113432 CTCTATACTTCACTCCAGCCTGG - Intronic
1122550675 14:102547688-102547710 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1122632778 14:103114706-103114728 CACTCCACTGCACTGCAGCCTGG - Intergenic
1122710479 14:103653363-103653385 CTCACTACTGCACTCCAGCCTGG - Intronic
1123685844 15:22796707-22796729 CACACTCCTACTCTGCAGCCAGG + Intronic
1124016264 15:25878435-25878457 CACTCCACTCCACTCCAGCCTGG + Intergenic
1124059619 15:26277909-26277931 CACTCTACTGCACTACAGCCTGG - Intergenic
1124116952 15:26853390-26853412 CTCACTACTGCACTCCAGCCTGG - Intronic
1124832559 15:33163081-33163103 CACTGTACTCCACTCCAGCCTGG + Intronic
1125352140 15:38779188-38779210 CTCTATAGACCTCTGCAGGCAGG - Intergenic
1125375875 15:39028846-39028868 CTCCCTGCTGCTGTGCAGCCCGG - Intergenic
1125727703 15:41876587-41876609 CTCACTCCTCCCCTGGAGCCTGG + Exonic
1125767492 15:42145298-42145320 CTGTCTGCCCCTCTTCAGCCTGG - Intronic
1126457029 15:48874404-48874426 TGCTCACCTCCTCTGCAGCCCGG - Intronic
1126763493 15:51990908-51990930 CTGGCCACTCCACTGCAGCCTGG + Intronic
1127263945 15:57346366-57346388 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1127484133 15:59403925-59403947 CACTCTACTGCACTCCAGCCTGG - Intronic
1127484216 15:59404502-59404524 CGCTCCACTGCTCTCCAGCCTGG - Intronic
1127511145 15:59643121-59643143 CTCACCACTGCACTGCAGCCTGG - Intronic
1127591364 15:60427462-60427484 CACTCTACTGCACTCCAGCCTGG - Intronic
1127925350 15:63534973-63534995 CACCCCACTCCACTGCAGCCTGG - Intronic
1128433944 15:67626974-67626996 CTCACCACTCCACTACAGCCCGG - Intronic
1128545498 15:68564345-68564367 CACTCTACCCCACTGCAGCCTGG - Intergenic
1128739879 15:70076342-70076364 CTTTCAACTCCCTTGCAGCCAGG + Intronic
1129130899 15:73494292-73494314 CTCGCTACTGCACTCCAGCCTGG + Intronic
1129281135 15:74485972-74485994 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1129320637 15:74772834-74772856 CGCTCTACTACACTCCAGCCTGG + Intergenic
1129513595 15:76142813-76142835 CTCTCTTCACCTCTGCACTCAGG + Intronic
1129858944 15:78845308-78845330 CTCGCTACTGCACTCCAGCCTGG - Intronic
1130233173 15:82112263-82112285 CTCTCTGCTCCTCTGCAGTGTGG - Intergenic
1130603572 15:85295057-85295079 CTCACTACTGCACTCCAGCCTGG + Intergenic
1131245162 15:90785585-90785607 CTCTCTACTGCACTGTAGTCTGG - Intronic
1132053335 15:98629975-98629997 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1132559809 16:588481-588503 CGCGCTACTGCACTGCAGCCTGG + Intergenic
1132735362 16:1383421-1383443 CTCTCAGCACCTCTGCAACCAGG - Intronic
1132935953 16:2481183-2481205 CTCTGTACTCCTCTGCACTCAGG + Intronic
1132977294 16:2717081-2717103 TTCTCTACTCCCCTGAGGCCAGG - Intronic
1133031029 16:3011325-3011347 CACTCCACTCCACTCCAGCCTGG - Intergenic
1133134012 16:3696768-3696790 CACTCTACTGCACTTCAGCCTGG - Intronic
1133366573 16:5215047-5215069 CTCTCCACTGCACTGCAGCCTGG + Intergenic
1133398955 16:5470750-5470772 GTCTGTCCGCCTCTGCAGCCTGG + Intergenic
1134008494 16:10834224-10834246 CTCTATCTTCCTCTCCAGCCCGG + Intergenic
1134008900 16:10836671-10836693 GTTTCTACTCCTCTGTACCCTGG - Intergenic
1134295635 16:12943043-12943065 CTCTCTCCTTCTCTGGAGCCTGG - Intronic
1134810425 16:17162364-17162386 CGCTCCACTCCACTCCAGCCTGG + Intronic
1134816944 16:17213660-17213682 CTCACTACTGCACTCCAGCCTGG - Intronic
1135083250 16:19454089-19454111 CACTCCACTCCACTCCAGCCTGG - Intronic
1135109466 16:19679547-19679569 CACACTACTGCACTGCAGCCCGG - Intronic
1135156163 16:20054769-20054791 CGCACTACTGCACTGCAGCCTGG - Intronic
1135346948 16:21696940-21696962 CACTCTACTGCACTCCAGCCTGG - Intronic
1135683902 16:24482297-24482319 CCCTCCACTGCACTGCAGCCTGG - Intergenic
1136050618 16:27647383-27647405 CACACTACTGCACTGCAGCCTGG - Intronic
1136219385 16:28818579-28818601 CTCACCACTGCACTGCAGCCTGG + Intergenic
1136236742 16:28918862-28918884 CTCACTACTGCACTCCAGCCTGG - Intronic
1137329180 16:47473105-47473127 CACTGTACTCCACTCCAGCCTGG - Intronic
1137537943 16:49341797-49341819 CGCTCTGCTTCTCTGCAGGCTGG - Intergenic
1137565770 16:49531663-49531685 CTCTCTCCTTCCCTTCAGCCTGG - Intronic
1137736163 16:50725471-50725493 CTCTCTTCTTCTCACCAGCCTGG + Exonic
1137932850 16:52604910-52604932 CTCTCTACTGCTCTTCAACAGGG - Intergenic
1138212406 16:55174453-55174475 ATCGCAACGCCTCTGCAGCCTGG + Intergenic
1138266027 16:55660279-55660301 CTTTCAAGGCCTCTGCAGCCTGG - Intronic
1138422749 16:56910377-56910399 CTCACTACTGCTCTCTAGCCTGG - Intronic
1138713824 16:58999052-58999074 CACACTACTGCACTGCAGCCTGG - Intergenic
1138889017 16:61118103-61118125 CTCGCTGATTCTCTGCAGCCAGG - Intergenic
1139057223 16:63200244-63200266 CTCTCCACTACACTCCAGCCTGG - Intergenic
1139309464 16:66016247-66016269 CTCTCTGGTTCTCTGCAGCCAGG + Intergenic
1140423566 16:74841572-74841594 CACTCTACTGCACTCCAGCCTGG + Intergenic
1140505086 16:75466354-75466376 CACTCCACTCCACTCCAGCCTGG - Intergenic
1141311525 16:82917869-82917891 CTCACTACTGCACTCCAGCCTGG + Intronic
1141349994 16:83285986-83286008 CTCTTTGCTCCTCTGAAACCTGG - Intronic
1141481795 16:84311570-84311592 CGCACTACTCCCCTCCAGCCTGG - Intronic
1141691193 16:85597511-85597533 CTCACTACTGCACTCCAGCCTGG - Intergenic
1141726257 16:85790868-85790890 CTCACCACTGCTCTCCAGCCCGG - Intronic
1142472655 17:172004-172026 CTGTGGACCCCTCTGCAGCCTGG - Intronic
1142614037 17:1124833-1124855 CTCTCCTCCCCTCTGCACCCAGG - Intronic
1142628921 17:1211233-1211255 CTCTCCACTTCTTTCCAGCCTGG + Intronic
1142629125 17:1212843-1212865 CTCTCCACTTCACTCCAGCCTGG + Intronic
1142629609 17:1216296-1216318 CGCTCTCCTCCTCTGGAGCAGGG - Intronic
1143080061 17:4375034-4375056 TTCTCTACTTCTCAGCAGCATGG - Intergenic
1143225454 17:5298697-5298719 CTCGCTACTGCACTCCAGCCTGG - Intronic
1143814487 17:9500959-9500981 CTCGCTACTGCACTCCAGCCTGG + Intronic
1144023513 17:11257615-11257637 CTCACCACTGCACTGCAGCCTGG + Intronic
1144368895 17:14571179-14571201 CACTCCACTGCACTGCAGCCTGG - Intergenic
1144413131 17:15020678-15020700 CTCACCACTCCACTCCAGCCTGG + Intergenic
1144517056 17:15925924-15925946 CTCTCTACTGCACTCCAGCCTGG + Intergenic
1144569930 17:16391034-16391056 CTCCCCACTGCTCTCCAGCCTGG + Intergenic
1144791838 17:17864252-17864274 CGCTCTACTACACTCCAGCCTGG - Intronic
1144964542 17:19068012-19068034 CACCCTACTGCACTGCAGCCTGG + Intergenic
1144983425 17:19184161-19184183 CACCCTACTGCACTGCAGCCTGG - Intergenic
1144984800 17:19194078-19194100 CACCCTACTGCACTGCAGCCTGG + Intergenic
1145219569 17:21077044-21077066 CACTCTTCTACTCTCCAGCCTGG + Intergenic
1145362079 17:22220818-22220840 CTCCCCACTGCTCTCCAGCCTGG + Intergenic
1145835663 17:27952574-27952596 CTGCCTACTCCCATGCAGCCCGG + Intergenic
1145935593 17:28712904-28712926 CTTTCTCCTCCTCTTCATCCTGG - Intergenic
1146046994 17:29517028-29517050 CTCGCCACTGCACTGCAGCCTGG - Intronic
1146213762 17:30962174-30962196 CACTCTACTGCACTCCAGCCTGG - Intergenic
1146214466 17:30968247-30968269 CACTCCACTCCACTCCAGCCTGG + Intergenic
1146410720 17:32581807-32581829 CGCTCTACTACACTCCAGCCTGG - Intronic
1146413133 17:32606059-32606081 CACTGTACTCCACTCCAGCCTGG + Intronic
1146505927 17:33405525-33405547 CGCGCCACTGCTCTGCAGCCTGG - Intronic
1146898913 17:36568338-36568360 CTCGCTACTGCACTCCAGCCTGG - Intronic
1147045974 17:37752478-37752500 CTCGCTCCTGCTCTGCAACCAGG - Intergenic
1147138187 17:38446847-38446869 CACACTACTGCTCTTCAGCCTGG - Intronic
1147181489 17:38688871-38688893 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1147630573 17:41928093-41928115 CTCACTACTGCACTCCAGCCTGG + Intronic
1147929545 17:43969470-43969492 CTCACTACTGCACTCCAGCCTGG + Intronic
1148024756 17:44579023-44579045 CTCACTACTACACTCCAGCCTGG - Intergenic
1148041853 17:44713573-44713595 CTCACTACACCTCTGCCTCCCGG - Intronic
1148104582 17:45112536-45112558 CCCTCTCCTCCTCTGGAGTCAGG - Exonic
1148142872 17:45340717-45340739 CACACTACTCCACTCCAGCCGGG - Intergenic
1148334987 17:46835036-46835058 CGCACTACTGCGCTGCAGCCTGG - Intronic
1148366729 17:47060949-47060971 CACACTACTGCACTGCAGCCTGG - Intergenic
1148416294 17:47509243-47509265 CACGCTACTGCTCTCCAGCCTGG + Intergenic
1148536816 17:48445968-48445990 TTCTCCTCTCCTCTGCATCCGGG + Intergenic
1148812225 17:50300781-50300803 CACTCCACTCCACTCCAGCCTGG + Intergenic
1149138593 17:53401833-53401855 CTCACTACTGCACTCCAGCCTGG - Intergenic
1149586479 17:57791101-57791123 CTCGCCACTGCACTGCAGCCTGG + Intergenic
1149682409 17:58515279-58515301 CTCTCTACTCCGCTGCTCCTGGG - Intronic
1150028019 17:61698756-61698778 CTCACTACTTCACTCCAGCCTGG - Intronic
1150857342 17:68765723-68765745 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1151613378 17:75191725-75191747 CACACTACTGCTCTCCAGCCTGG + Intergenic
1151763690 17:76121665-76121687 CTCTCCCTTCCTCTGCACCCTGG - Intergenic
1152041601 17:77907253-77907275 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1152452814 17:80393544-80393566 CTCTCTCCTCGTCTGCGGCGTGG + Exonic
1152614715 17:81332521-81332543 CTCACCACTGCCCTGCAGCCTGG - Intergenic
1152701894 17:81823509-81823531 CACTCTCTGCCTCTGCAGCCTGG - Exonic
1152826062 17:82465609-82465631 CTCTCCACTGCACTCCAGCCTGG - Intronic
1153018877 18:608672-608694 CTCACTACTACACTCCAGCCTGG + Intronic
1153038605 18:788880-788902 CTCTCCACTGCACTCCAGCCTGG + Intronic
1153601842 18:6788503-6788525 CACTCTACTGCACTCCAGCCTGG - Intronic
1153896738 18:9569393-9569415 CGCACTACTGCACTGCAGCCTGG - Intronic
1154060815 18:11058070-11058092 CTCTCTACTGTTCTGTAGACCGG - Intronic
1154242921 18:12668780-12668802 CTCTCCACTACACTCCAGCCTGG - Intronic
1154326808 18:13397185-13397207 CTCACCACTGCTCTCCAGCCTGG - Intronic
1155210286 18:23594736-23594758 CTCACTACTGCACTCCAGCCTGG - Intergenic
1155272121 18:24150821-24150843 CTCACTACTGCACTCCAGCCTGG - Intronic
1155471907 18:26200306-26200328 CTCATTACTACACTGCAGCCCGG + Intergenic
1155679468 18:28472361-28472383 CTCTTGTCTCCTCTGCAGCAAGG - Intergenic
1156337401 18:36183731-36183753 TTCTCTAGCGCTCTGCAGCCTGG + Intergenic
1156539116 18:37892502-37892524 CACACCACTCCTCTCCAGCCTGG - Intergenic
1156748893 18:40426275-40426297 CGCGCTACTGCTCTCCAGCCCGG - Intergenic
1156823321 18:41399142-41399164 CTACCTACTGCTGTGCAGCCCGG - Intergenic
1156928078 18:42607284-42607306 CACACTACTGCACTGCAGCCTGG - Intergenic
1157492608 18:48135017-48135039 CCCTCTCCTCCTCTTCATCCAGG + Intronic
1157959949 18:52142384-52142406 CACGCTGCTCCTCTCCAGCCTGG - Intergenic
1158062107 18:53356882-53356904 CTCTTTTCTCTTTTGCAGCCTGG + Intronic
1158685260 18:59607999-59608021 CTCACTACACCTCTGCTTCCTGG - Intronic
1158962472 18:62597827-62597849 CTCGCTACTGCACTCCAGCCTGG + Intergenic
1159380604 18:67652511-67652533 CTCTATTCTCCTTTGCAGTCTGG - Intergenic
1159501283 18:69274231-69274253 CTCGCCCCTCCACTGCAGCCTGG + Intergenic
1159890904 18:73952326-73952348 CTTTCTACTCCTCTGTTGCAGGG - Intergenic
1160118664 18:76107432-76107454 CTCTCTTTTCCTCTCCATCCAGG + Intergenic
1160615976 18:80129145-80129167 CTCACCACTGCACTGCAGCCTGG - Intronic
1160670201 19:358695-358717 CTCTCAATTTCTCTGTAGCCTGG - Intergenic
1160886242 19:1349927-1349949 CTCACTACTTCACTCCAGCCTGG + Intergenic
1161071702 19:2265500-2265522 CTCTCAACTGCACTGCAGCCTGG - Intronic
1161448748 19:4332782-4332804 CTCACTACTGCACTCCAGCCTGG + Intronic
1161539951 19:4844592-4844614 CTCTCTACACCTCTGCTTCATGG - Intronic
1161694229 19:5756897-5756919 CTCACCACTGCACTGCAGCCTGG + Intronic
1161888503 19:7016160-7016182 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1162247070 19:9410254-9410276 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1162417406 19:10546387-10546409 CTCTCCACTGCACTTCAGCCAGG - Intronic
1162567453 19:11451986-11452008 CTCTCCTCTCCCCTGCAGCAGGG - Exonic
1162694619 19:12463881-12463903 CACTCTACTGCACTCCAGCCAGG + Exonic
1162705838 19:12554248-12554270 ATCACTACTGCACTGCAGCCTGG + Intronic
1162730476 19:12715538-12715560 CTCTCTGCCCCTCTGCACTCAGG - Exonic
1162815019 19:13188685-13188707 CGCTCCACTCCACTCCAGCCTGG - Intergenic
1162828282 19:13267822-13267844 CCCGCTACTGCACTGCAGCCTGG - Intronic
1162921402 19:13905462-13905484 CGCTCTACTGCACTCCAGCCTGG + Intronic
1163030473 19:14540876-14540898 CACTCTACTGCACTCCAGCCTGG - Intronic
1163110279 19:15156278-15156300 CTCGCCACTCCACTCCAGCCTGG + Intergenic
1163450592 19:17374860-17374882 CTCACTACTGCACTCCAGCCTGG - Intronic
1163460363 19:17433758-17433780 CGCACCACTCCTCTCCAGCCTGG - Intergenic
1163461589 19:17441162-17441184 CACTCTACTGCACTTCAGCCTGG + Intronic
1163534082 19:17867028-17867050 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1163568154 19:18064045-18064067 CTCTTTACTCCTCAGAGGCCAGG + Intronic
1163690120 19:18734056-18734078 CGCGCCACTCCACTGCAGCCTGG + Intronic
1163749447 19:19066976-19066998 CACTGCACTCCTCTCCAGCCTGG + Intronic
1164186821 19:22877706-22877728 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1164691813 19:30216950-30216972 CTCACCACTGCTCTACAGCCTGG - Intergenic
1164874635 19:31675263-31675285 CTCGCTTCTCCTCTGCACCTGGG + Intergenic
1164895714 19:31875785-31875807 CTCGCTAATCCTCTGCAGTATGG + Intergenic
1164955173 19:32376889-32376911 CTCTCTCTGCCTCTGCTGCCAGG - Intronic
1165031845 19:33003312-33003334 CTCACTACTGCACTCCAGCCTGG + Intronic
1165156147 19:33789710-33789732 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1165325228 19:35110675-35110697 CTCACCACTGCACTGCAGCCTGG + Intergenic
1165669835 19:37666793-37666815 CTCACCACTCCACTCCAGCCTGG - Intronic
1166345823 19:42164916-42164938 CTCTCCACTGCACTCCAGCCTGG + Intronic
1166516624 19:43451891-43451913 CTCTCTACTGCACTCTAGCCTGG + Intergenic
1166544436 19:43625749-43625771 CTCTCTCCTCCTCAGGACCCAGG + Intronic
1166939590 19:46354751-46354773 CTCACCACTCCACTCCAGCCTGG + Intronic
1167073841 19:47236870-47236892 CGCGCTACTGCACTGCAGCCTGG + Intergenic
1167217331 19:48173340-48173362 CGCACTACTGCTCTCCAGCCTGG - Intronic
1167241766 19:48347980-48348002 CACTCCACTCCACTCCAGCCTGG + Intronic
1167460996 19:49624729-49624751 GTCTCTCCTGATCTGCAGCCTGG + Intronic
1167466712 19:49654033-49654055 CTCTCCCCACCTCTGCAGTCTGG - Intronic
1167480185 19:49725543-49725565 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1167615989 19:50534154-50534176 CTCTCTTCTTCTCTGAGGCCAGG - Intronic
1167890948 19:52538785-52538807 CTCACCACTCATCTGCACCCAGG - Intronic
1167920998 19:52783297-52783319 CTCACCACTCATCTGCACCCAGG + Intronic
1167946776 19:52994477-52994499 CTCGCCACTGCACTGCAGCCTGG - Intergenic
1167976308 19:53229159-53229181 CACACTACTGCACTGCAGCCTGG + Intergenic
1167997600 19:53418859-53418881 CACTCTACTTCACTCCAGCCTGG + Intronic
1168088562 19:54066427-54066449 CTCACCACTGCACTGCAGCCTGG - Intergenic
1168323950 19:55528703-55528725 CTCTCTCCTTCTCTCCGGCCGGG - Intergenic
1168335256 19:55593519-55593541 CTCCCCTCTCCCCTGCAGCCCGG - Exonic
1168653278 19:58107515-58107537 CACACTACTGCACTGCAGCCTGG + Intronic
925098244 2:1224453-1224475 CTCTCGCCTCCTCTGCTGCATGG + Intronic
925422793 2:3725784-3725806 CTCTCTACTCATCTCCCTCCGGG - Intronic
926048906 2:9730565-9730587 CTCTGTGCTCTTCTCCAGCCAGG - Intergenic
926171919 2:10558033-10558055 CTCTGTCCTCCGCTGCACCCAGG + Intergenic
926320515 2:11745997-11746019 CTCCCTGCGCCTCTCCAGCCGGG - Intronic
926606909 2:14907121-14907143 CTTTCTACCCCACAGCAGCCAGG - Intergenic
927586896 2:24316322-24316344 CACTCTGCTGCTCTCCAGCCTGG - Intronic
927701741 2:25273536-25273558 CTCTCTTTTCCTGTGCAGCTAGG + Intronic
928146601 2:28783711-28783733 CACGCTACTGCACTGCAGCCTGG + Intronic
928570150 2:32598976-32598998 CTCGCCACTGCACTGCAGCCTGG + Intronic
928969606 2:37014203-37014225 CACGCCACTCCGCTGCAGCCTGG - Intronic
928986002 2:37182295-37182317 CTCGCCACTGCTCTCCAGCCTGG - Intronic
929115573 2:38441213-38441235 CTCCCGACTCCTGTTCAGCCTGG - Intergenic
929191585 2:39145454-39145476 CTCTCCACTGCCCTCCAGCCTGG - Intergenic
929253736 2:39786661-39786683 CTCTCCACTGCACTCCAGCCTGG + Intergenic
929525944 2:42702996-42703018 CACTGTACTCCACTCCAGCCTGG - Intronic
929623759 2:43385095-43385117 CTCACTACTGCTCTCTAGCCCGG + Intronic
930674942 2:54190545-54190567 CTCTCTTCTCCTTGGCTGCCAGG + Intronic
930799456 2:55427821-55427843 CGCGCTACTGCACTGCAGCCTGG - Intergenic
931359513 2:61566251-61566273 CTCGCCACTGCACTGCAGCCTGG - Intergenic
931483873 2:62670968-62670990 CTCTCTTCACCTATTCAGCCTGG + Intergenic
931612508 2:64117851-64117873 CGCTCCACTCCACTCCAGCCTGG - Intronic
931773311 2:65518024-65518046 CTCACCACTGCACTGCAGCCTGG + Intergenic
931859611 2:66341182-66341204 CTCACTACTACACTCCAGCCTGG - Intergenic
932399771 2:71471920-71471942 CTCACCACTGCTCTCCAGCCTGG + Intronic
933241574 2:79927329-79927351 CACTCTCCACCTCTGCAGGCAGG - Intronic
933530678 2:83506600-83506622 CTCACCACTGCACTGCAGCCTGG + Intergenic
933947655 2:87300527-87300549 CTCACCACTGCTCTTCAGCCTGG + Intergenic
934078280 2:88446521-88446543 CTCACTACTGCACTTCAGCCTGG + Intergenic
934464934 2:94253411-94253433 CACGCCACTCCACTGCAGCCTGG - Intergenic
934528047 2:95064252-95064274 CGCGCTACTGCACTGCAGCCTGG - Intergenic
934807868 2:97252517-97252539 CTCGCCACTGCACTGCAGCCTGG - Intronic
934829642 2:97504670-97504692 CTCGCCACTGCACTGCAGCCTGG + Intronic
935139602 2:100341129-100341151 CACACTACTGCTCTCCAGCCTGG - Intergenic
935164942 2:100562392-100562414 CTCTCCACTGCACTCCAGCCTGG - Intergenic
935294101 2:101633161-101633183 CTCGCTATTGCACTGCAGCCTGG + Intergenic
935553775 2:104485061-104485083 CACTCCACTGCTCTCCAGCCTGG + Intergenic
935656286 2:105426502-105426524 CTCTCTTCTGCTCTGCACCAGGG + Intronic
936332540 2:111561050-111561072 CTCACCACTGCTCTTCAGCCTGG - Intergenic
936400659 2:112162062-112162084 CACTCCACTGCTCTCCAGCCTGG - Intronic
936526655 2:113246111-113246133 GACTCTAATTCTCTGCAGCCAGG - Intronic
937321514 2:120963702-120963724 ACCTCTCCTCCTCTGCACCCTGG + Intronic
937389953 2:121476700-121476722 CTCTCTGCTTCACTGCAGCAGGG + Intronic
937482664 2:122278591-122278613 CACGCTACTCCACTCCAGCCTGG - Intergenic
938149590 2:128870634-128870656 CTCTCCACTGCACTCCAGCCTGG + Intergenic
938415419 2:131100035-131100057 CACTCCACTACACTGCAGCCTGG + Intergenic
938816791 2:134912944-134912966 CACGCTACTGCACTGCAGCCTGG - Intergenic
939170447 2:138689322-138689344 CACTCTCCTCCTCTGGGGCCAGG - Intronic
939728819 2:145756559-145756581 CTCACTACTGCACTCCAGCCTGG - Intergenic
940145157 2:150538169-150538191 CTCGCCACTGCACTGCAGCCTGG - Intronic
940316186 2:152329947-152329969 CTCACCACTGCACTGCAGCCTGG + Intergenic
942230078 2:173852795-173852817 CTCGCTACTGCACTCCAGCCTGG - Intergenic
942464036 2:176189233-176189255 CTCTTTCCTCCTCAGCGGCCAGG + Exonic
943029781 2:182671661-182671683 CGCTCCACTGCACTGCAGCCTGG - Intergenic
943460430 2:188165988-188166010 CTCACTACTGCACTCCAGCCTGG - Intergenic
943974265 2:194450550-194450572 CTCACCACTGCTCTCCAGCCTGG + Intergenic
944172185 2:196792199-196792221 CACTCCACTGCACTGCAGCCTGG - Intronic
944466748 2:200009365-200009387 CTCACTACTGCACTCCAGCCTGG - Intergenic
944588465 2:201194820-201194842 CACACTACTGCACTGCAGCCTGG - Intronic
944739374 2:202596801-202596823 CGCACTACTGCACTGCAGCCTGG - Intergenic
944743183 2:202632487-202632509 CTCGCCACTGCACTGCAGCCTGG - Intergenic
944782525 2:203034199-203034221 CGCTCTACTGCACTCCAGCCTGG - Intronic
945299297 2:208200857-208200879 CTCTCCACTGCACTCCAGCCTGG - Intergenic
945844652 2:214929663-214929685 CTCTCCACTGCACTCCAGCCTGG + Intergenic
946016183 2:216605922-216605944 CGCTCTACTGCACTCCAGCCTGG - Intergenic
946132036 2:217613871-217613893 CTCGCCACTGCACTGCAGCCTGG + Intronic
946827622 2:223695073-223695095 CACTCCACTGCACTGCAGCCTGG + Intergenic
947524808 2:230871543-230871565 CTGTCATCTCCTCAGCAGCCAGG - Intronic
947539830 2:230968743-230968765 CTCTTTTCTCCTCTGCAATCTGG + Intergenic
948185369 2:236017247-236017269 CACTCCACTGCACTGCAGCCTGG + Intronic
948237261 2:236400420-236400442 CCCTCTGCCCCTCTGCCGCCAGG + Intronic
948377748 2:237532942-237532964 CTCTCAGCCCTTCTGCAGCCCGG + Intronic
948746502 2:240098703-240098725 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1168764628 20:373299-373321 CACCCTACTGCACTGCAGCCTGG + Intronic
1168793115 20:593309-593331 CTCACTACTACACTCCAGCCTGG - Intergenic
1169081071 20:2798058-2798080 CTCTCTCCACCTCTCCTGCCAGG - Exonic
1170148028 20:13198947-13198969 CTCACTACTGCAGTGCAGCCTGG - Intergenic
1170587930 20:17749697-17749719 CTCTCATCTCCTCTCCACCCTGG + Intergenic
1170966116 20:21073170-21073192 TTCTCTACTTCACTCCAGCCAGG - Intergenic
1170989198 20:21286698-21286720 CACACTACTCCACTGCACCCTGG + Intergenic
1171103028 20:22403971-22403993 CTATCTGCTCTCCTGCAGCCCGG - Intergenic
1171227804 20:23455951-23455973 CTCCCCACTCCCCTGCAGGCTGG + Intergenic
1171521405 20:25777404-25777426 CTCACCACTCCACTCCAGCCTGG - Intronic
1171555406 20:26078462-26078484 CTCACCACTCCACTCCAGCCTGG + Intergenic
1172203579 20:33145841-33145863 TACTCTACCCCTCTGTAGCCAGG + Intergenic
1172770405 20:37379158-37379180 CTCTGGACTCCTCAGCAGACAGG - Intronic
1172905435 20:38365651-38365673 CTCACTACTTCACTGCAGCCTGG + Intronic
1172927798 20:38555038-38555060 CACTCCACTCCACTCCAGCCTGG + Intronic
1173039705 20:39450911-39450933 CTCACTACTCCACTCCAGCCTGG - Intergenic
1173115475 20:40238103-40238125 CACTCTACTGCACTCCAGCCTGG + Intergenic
1173189155 20:40863072-40863094 TTCTTCCCTCCTCTGCAGCCTGG + Intergenic
1173271197 20:41536847-41536869 CTCTCTATTCCTCAGGAGCTTGG - Intronic
1173294357 20:41742869-41742891 CGCACCACTGCTCTGCAGCCTGG - Intergenic
1173665791 20:44762231-44762253 CGCTCACCTGCTCTGCAGCCTGG + Intronic
1174130477 20:48340560-48340582 CTCCCTGCTGCTCTGTAGCCTGG - Intergenic
1174320562 20:49738689-49738711 CACGCCACTCCACTGCAGCCTGG + Intergenic
1174523786 20:51155383-51155405 CTCTCTTCTCTTGTGCAGCTTGG + Intergenic
1174603045 20:51740098-51740120 CTCGCCACTGCACTGCAGCCTGG - Intronic
1174817372 20:53698337-53698359 CTCGCCACTGCTCTGAAGCCTGG - Intergenic
1174954336 20:55080059-55080081 CTCACTACTGCACTCCAGCCTGG + Intergenic
1176251418 20:64122360-64122382 CTCACTACTGCACTCCAGCCTGG + Intergenic
1176924522 21:14731571-14731593 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1177308410 21:19352709-19352731 CTCACTACTGCACTCCAGCCTGG - Intergenic
1177584165 21:23068653-23068675 CTCTCTACTCCTAATCAGTCTGG - Intergenic
1177628534 21:23697969-23697991 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1178435404 21:32553698-32553720 CTCGCTACTCCACTCCAGCCTGG + Intergenic
1178546767 21:33499055-33499077 CGCGCTACTCCACTCCAGCCTGG + Intergenic
1178801036 21:35795923-35795945 CACTCTACTACACTCCAGCCTGG + Intronic
1178857340 21:36261319-36261341 CTCACCACTGCTCTCCAGCCTGG + Intronic
1178952065 21:36993242-36993264 CTCACTACTGCACTCCAGCCTGG + Intergenic
1179111404 21:38448957-38448979 GTCTCTCCTTCCCTGCAGCCTGG + Intronic
1179131196 21:38638823-38638845 CTTTCTGATCCCCTGCAGCCAGG + Intronic
1179194989 21:39156380-39156402 CACGCTACTGCTCTCCAGCCTGG - Intergenic
1179199923 21:39207383-39207405 CTCACCACTGCTCTCCAGCCTGG + Intronic
1179278420 21:39912752-39912774 CTCACTACTGCACTCCAGCCTGG - Intronic
1179615533 21:42580827-42580849 CTCTCTGCTTCTCTGCTGGCCGG - Exonic
1179636757 21:42716792-42716814 CTCACTACTGCACTCCAGCCTGG - Intronic
1179636839 21:42717498-42717520 CTCACTACTGCACTCCAGCCTGG + Intronic
1179779722 21:43691680-43691702 CTCGCCACTGCACTGCAGCCTGG - Intronic
1179837757 21:44048535-44048557 CTCACTACTACACTCCAGCCTGG - Intronic
1179899396 21:44381182-44381204 TTCTCTCCTCGTCCGCAGCCTGG - Intronic
1180301006 22:11036541-11036563 CGCACTACTGCACTGCAGCCTGG + Intergenic
1180687798 22:17683916-17683938 CTCACTACTGCACTCCAGCCTGG - Intronic
1180957487 22:19747432-19747454 CTCCTCACACCTCTGCAGCCTGG - Intergenic
1180970037 22:19810484-19810506 CTCACCACTCCCCTGCACCCAGG - Intronic
1181318076 22:21983962-21983984 CTCGCTACTGCGCTCCAGCCTGG - Intergenic
1181770083 22:25118907-25118929 CTCTCTTCACCTCTGCAGAGAGG + Intronic
1182513983 22:30841987-30842009 CTCTCCACTGCACTCCAGCCTGG - Intronic
1183183812 22:36280104-36280126 CGCTCCACTGCTCTCCAGCCTGG + Intergenic
1183223866 22:36535858-36535880 CGCTCTACTGCACTCCAGCCTGG + Intergenic
1183552374 22:38497572-38497594 CTCGCTACTGCACTCCAGCCTGG + Intronic
1183636852 22:39069180-39069202 CTCTCCACTGCACTCCAGCCTGG + Intronic
1183655502 22:39182319-39182341 CTCTCTCCTCCCTTGCAGCAAGG - Intergenic
1183796765 22:40124967-40124989 CTCACCACTGCACTGCAGCCTGG + Intronic
1184043468 22:41958004-41958026 CACGCTATCCCTCTGCAGCCTGG + Intergenic
1184058812 22:42069574-42069596 CACTCTACTCCACTCCAGCCTGG + Intronic
1184466606 22:44672184-44672206 CTCCCTACTCCTCTGGGGCAGGG - Intronic
1185136666 22:49077327-49077349 CTGGCCACTTCTCTGCAGCCTGG - Intergenic
949850294 3:8413764-8413786 CTCTCTCTTTCTCTGCAGCCAGG - Intergenic
949861360 3:8508113-8508135 CTCTCTACTAGTCTTCTGCCGGG - Intronic
949907793 3:8873130-8873152 ATCGCCACTGCTCTGCAGCCTGG + Intronic
951032359 3:17896246-17896268 CCCACTACTCCTCTGCTGCCAGG + Intronic
951821700 3:26821102-26821124 CTCTCTCTTCCTCTGCAAACTGG + Intergenic
951940169 3:28069219-28069241 CTCGCTACTGCACTCCAGCCTGG - Intergenic
953169764 3:40496441-40496463 CTCCCCACTCCACTCCAGCCTGG - Intergenic
953427698 3:42809035-42809057 CACGCTACTCCACTCCAGCCTGG - Intronic
953692308 3:45130163-45130185 CACACCACTGCTCTGCAGCCTGG - Intronic
954371934 3:50173596-50173618 CTCGCTACTGTACTGCAGCCTGG + Intronic
955473617 3:59313000-59313022 CTCACTACTGCACTCCAGCCTGG - Intergenic
955688385 3:61566549-61566571 CTCACTACTGCACTCCAGCCTGG - Intronic
956212572 3:66816803-66816825 CACCCTACTGCTCTCCAGCCTGG - Intergenic
956305658 3:67821591-67821613 CCCTCTACCCCTCTGCCTCCAGG + Intergenic
956824001 3:72980616-72980638 CGCGCTACTGCTCTCCAGCCTGG - Intronic
957245660 3:77712620-77712642 ATCTCTATCCCTCTGCAGTCTGG - Intergenic
957900967 3:86489303-86489325 CTCGCCACTGCACTGCAGCCTGG - Intergenic
958197170 3:90256137-90256159 ATCTCTCCTCCTCTGCATCTAGG + Intergenic
959686782 3:109156264-109156286 CACACTACTGCTCTCCAGCCTGG - Intergenic
960045119 3:113189750-113189772 CACTCCACTCCACTCCAGCCTGG + Intergenic
960282057 3:115791424-115791446 CTCTCTGCTCCTCCTCTGCCCGG + Intergenic
960282362 3:115793377-115793399 TTCTCTACTCTTCTCCAGACTGG - Intergenic
961385282 3:126519840-126519862 ATCTCTGCTCCTCACCAGCCAGG + Intergenic
961802912 3:129466543-129466565 CGCACTACTGCACTGCAGCCTGG - Intronic
961915010 3:130365319-130365341 CTCGCCACTGCTCTCCAGCCTGG - Intronic
962133335 3:132706313-132706335 CGCTCTACTGCACTCCAGCCTGG + Intronic
962197862 3:133379369-133379391 CTGCCTCTTCCTCTGCAGCCAGG - Intronic
962264124 3:133933737-133933759 CTCTCTACTCCTCGGAATACGGG + Exonic
963085339 3:141430636-141430658 CTCCCTGCCCCTCTGCACCCTGG - Intronic
963129207 3:141842591-141842613 CCCTCTACTGCTTTTCAGCCTGG - Intergenic
963391867 3:144674652-144674674 CTCTCCACTGCACTTCAGCCTGG + Intergenic
963700559 3:148620015-148620037 CACTGCACTCCACTGCAGCCTGG + Intergenic
964868496 3:161288025-161288047 CGCTCCACTGCTCTCCAGCCTGG + Intergenic
965168829 3:165234048-165234070 CTCACCACTGCACTGCAGCCTGG - Intergenic
966980821 3:185133698-185133720 CACACTACTGCACTGCAGCCTGG + Intronic
967091750 3:186140466-186140488 CGCTCTACTGCACTCCAGCCTGG + Intronic
967141945 3:186568857-186568879 CACGCTACTGCTCTCCAGCCTGG + Intronic
967899823 3:194438114-194438136 CTCACTACTGCACTCCAGCCGGG + Intronic
968337088 3:197923160-197923182 CTCCCCACTGCACTGCAGCCTGG - Intronic
968586389 4:1418557-1418579 CTCTCTCCTGCACTCCAGCCTGG - Intergenic
968627767 4:1635315-1635337 CACACTACTCCACTCCAGCCTGG - Intronic
968811403 4:2801127-2801149 CTCTCTGCACCCCTGCAGTCTGG - Intronic
969140355 4:5065765-5065787 CACGCTACTGCTCTCCAGCCTGG - Intronic
969147843 4:5139621-5139643 CTCTCTACCCCACTTCTGCCTGG - Intronic
969331765 4:6477685-6477707 CACTGTACTCCACTCCAGCCTGG + Intronic
969400070 4:6948741-6948763 CTCACTACTGCACTCCAGCCTGG - Intronic
969534500 4:7747536-7747558 CACTCAGCTTCTCTGCAGCCTGG - Intergenic
969565032 4:7972269-7972291 TTCTCCACTCCTCTGCTGCGTGG + Intronic
969614332 4:8243565-8243587 CACGCTACTGCACTGCAGCCTGG - Intergenic
969657253 4:8505420-8505442 CTCCCAGCACCTCTGCAGCCCGG + Intergenic
969918358 4:10512272-10512294 CTCACTACTGCACTCCAGCCTGG - Intronic
970824188 4:20253144-20253166 CCCTCGACTCCGCCGCAGCCTGG - Intergenic
971423032 4:26491229-26491251 CGCGCCACTCCACTGCAGCCTGG - Intergenic
972413185 4:38813316-38813338 CACACTACTGCTCTCCAGCCTGG + Intronic
972718418 4:41672324-41672346 CACACTACTGCACTGCAGCCTGG + Intronic
972743443 4:41910321-41910343 TGCTCTACTGCACTGCAGCCTGG - Intergenic
972821874 4:42711224-42711246 CACTGCACTCCTCTCCAGCCAGG - Intergenic
972997142 4:44894714-44894736 CTCTCTGCCCATCTGCAGACTGG - Intergenic
973321934 4:48818527-48818549 ATCTCTACTCCTCTCCAGCAAGG + Intronic
973563582 4:52161846-52161868 CTCCCACCTCCTCTGGAGCCTGG + Intergenic
974231581 4:59122597-59122619 CTCGCCACTGCACTGCAGCCTGG - Intergenic
974840221 4:67290797-67290819 CTCTCTACCCCTCAGCACCAAGG + Intergenic
975351919 4:73356859-73356881 TGCACTACTCCACTGCAGCCTGG - Intergenic
975748301 4:77496002-77496024 TCATCTACTCCTGTGCAGCCTGG - Intergenic
975917479 4:79341816-79341838 CTCTCCACTGCACTCCAGCCTGG + Intergenic
976184719 4:82431952-82431974 CACTCCACTCCACTCCAGCCTGG - Intronic
976249893 4:83039673-83039695 CTCTCTACTGCACTCAAGCCAGG - Intronic
976317427 4:83673500-83673522 GTCACTGCTCCTCTGCAGGCTGG + Intergenic
976398996 4:84586604-84586626 CACTCACCTGCTCTGCAGCCGGG + Intronic
976806118 4:89049217-89049239 CTCACTACTGCACTCCAGCCTGG + Intronic
978616677 4:110603931-110603953 CTCTCTCCTCCTCTGCACTTGGG - Intergenic
978714090 4:111820772-111820794 CTCTCCACTGCTCTCCATCCTGG + Intergenic
978764731 4:112392563-112392585 CACTGTACTGCACTGCAGCCTGG - Intronic
979096735 4:116560175-116560197 CTCACTACTGCACTTCAGCCTGG + Intergenic
979128592 4:117009661-117009683 CTCGCTACTGCACTCCAGCCTGG - Intergenic
979665254 4:123304193-123304215 CCATCTGCTGCTCTGCAGCCAGG + Intronic
980810824 4:137877054-137877076 CACTCTACTGCACTCCAGCCTGG - Intergenic
980930898 4:139181722-139181744 CTCACCACCCCACTGCAGCCTGG + Intergenic
981320745 4:143388456-143388478 CGCTCTACTGCTCTCCAGCCTGG - Intronic
981813970 4:148807313-148807335 CTCACCACTGCACTGCAGCCTGG + Intergenic
982024629 4:151239354-151239376 CTCTCCACACCTCTGCAAGCTGG + Intronic
982231231 4:153210106-153210128 CTCGCCACTGCTCTCCAGCCTGG - Intronic
982286186 4:153738091-153738113 CTCTCCACTGCACTCCAGCCTGG - Intronic
982325248 4:154123265-154123287 CACACTACTCCACTCCAGCCTGG + Intergenic
983244695 4:165274563-165274585 CTCTCCACTGCACTCCAGCCTGG + Intronic
983258366 4:165428071-165428093 CTCACAACTCCACTGCAGACTGG - Intronic
983494270 4:168425723-168425745 CACTCTACTGCACTCCAGCCTGG + Intronic
983502408 4:168514065-168514087 CACTGTACTCCACTCCAGCCTGG + Intronic
984237183 4:177173922-177173944 CGCACTACTGCTCTCCAGCCTGG - Intergenic
984249724 4:177317645-177317667 CTCTCAACAGCACTGCAGCCTGG - Intronic
984734480 4:183098040-183098062 CCCTGGACTCCTCTCCAGCCGGG - Intergenic
984862412 4:184252801-184252823 CTCTCAGCGCCTCTTCAGCCTGG + Intergenic
984914520 4:184709441-184709463 CTCTCCACTCTACTCCAGCCTGG + Intronic
985261101 4:188115671-188115693 CGCTCCACTCCACTCCAGCCTGG + Intergenic
986027337 5:3863446-3863468 CTCTCTCCTCCCCTGCAGCCTGG + Intergenic
986514898 5:8551167-8551189 CACTATATTTCTCTGCAGCCAGG + Intergenic
986680920 5:10232158-10232180 CGCTCTACTGCACTGCAGTCTGG + Intronic
986846369 5:11760310-11760332 CTATCTACTCCACAGGAGCCTGG + Intronic
987049795 5:14139926-14139948 CTCGCCACTGCTCTCCAGCCTGG - Intergenic
987201851 5:15585006-15585028 CTTTCAACTACTCTGCTGCCTGG + Intronic
987840585 5:23218392-23218414 CTCTCTGCTCCTATGCACCAAGG - Intergenic
987922634 5:24303423-24303445 CTCGCTACTGCACTGCAGACTGG + Intergenic
987972615 5:24967605-24967627 CTCTCCACTGCACTCCAGCCTGG + Intergenic
988353078 5:30137738-30137760 CTCACCACTGCACTGCAGCCTGG - Intergenic
988541807 5:32116801-32116823 CACACTACTACACTGCAGCCTGG + Intergenic
989235795 5:39147311-39147333 CTCTCCACTACACTCCAGCCTGG - Intronic
989803037 5:45568060-45568082 CACTCTACTCACGTGCAGCCAGG + Intronic
990581516 5:57171393-57171415 CTCTCCACTGCACTCCAGCCTGG - Intergenic
991674461 5:69077151-69077173 CTCTCTATTGCACTCCAGCCTGG + Intergenic
991674543 5:69078015-69078037 CTCACTACTGCACTCCAGCCTGG - Intergenic
991703312 5:69335154-69335176 CTCGCCACTGCACTGCAGCCTGG - Intergenic
992204012 5:74412279-74412301 CCATCTGCTCCTTTGCAGCCTGG + Intergenic
992303226 5:75406582-75406604 CTCGCTACTGCACTCCAGCCTGG - Intronic
992607922 5:78480000-78480022 CTCTCCACTGCACTCCAGCCTGG + Intergenic
993611294 5:90057623-90057645 CTCACTACTGCACTCCAGCCTGG + Intergenic
993639111 5:90380892-90380914 CACTCTACTGCACTCCAGCCTGG - Intergenic
993951993 5:94187468-94187490 CTCGCTACTGCACTCCAGCCTGG - Intronic
994094439 5:95836020-95836042 CACTCACCTCCTCTGTAGCCAGG - Intergenic
994638681 5:102377118-102377140 CTCTCCACTTCACTCCAGCCTGG + Intronic
994641316 5:102412715-102412737 CTCTCCACTGCACTCCAGCCTGG + Intronic
994675133 5:102811437-102811459 CTCTCTGGTTCTCTGCAGCCAGG + Intronic
994937355 5:106272214-106272236 CTCTCAACTCCTCAGCCCCCAGG + Intergenic
995088162 5:108140087-108140109 GACTCTACTGCACTGCAGCCTGG - Intronic
995231729 5:109772323-109772345 CTCTCCACTGCACTCCAGCCTGG + Intronic
995504850 5:112849311-112849333 CTCACCACTGCACTGCAGCCTGG + Intronic
995641103 5:114258742-114258764 CTCTCAGCTACACTGCAGCCTGG - Intergenic
995806642 5:116060194-116060216 CGCGCTACTGCACTGCAGCCTGG - Intergenic
996399821 5:123049747-123049769 CTCACTACTGCACTCCAGCCTGG - Intergenic
996426490 5:123319350-123319372 ATCACAACTCCTCTGCAGCAAGG - Intergenic
996766151 5:127035948-127035970 CCCTCTCCTCCTCTGAACCCTGG - Intergenic
997138762 5:131355431-131355453 TGCTCCACTCCACTGCAGCCTGG + Intronic
997452031 5:133991428-133991450 CTCTGTACTGCCCTGGAGCCAGG - Intronic
997666902 5:135636934-135636956 CTCTCTATCCCTCTGCACCAAGG - Intergenic
997935361 5:138105728-138105750 CGCTCTACTGCACTCCAGCCAGG + Intergenic
998122263 5:139588307-139588329 CACTCCACTCCACTCCAGCCTGG - Intronic
998834387 5:146189983-146190005 CGCTCCACTGCACTGCAGCCTGG - Intergenic
999458115 5:151734816-151734838 CACTCTACTGCACTCCAGCCTGG + Intergenic
999502245 5:152159321-152159343 ATCACAACTCCTCTGCAGCAAGG - Intergenic
999630511 5:153566348-153566370 CGCACCACTCCACTGCAGCCTGG - Intronic
999933035 5:156454717-156454739 CACTCAACTCTCCTGCAGCCAGG - Intronic
1000099252 5:157998982-157999004 CTCACTACTGCACTCCAGCCTGG + Intergenic
1000427302 5:161106766-161106788 CTCTGCACTCCACTCCAGCCTGG + Intergenic
1000534337 5:162461511-162461533 CTCACTACTGCACTACAGCCTGG + Intergenic
1001687683 5:173606750-173606772 CTCTCTACTACTAGGCAGACAGG - Intergenic
1001728593 5:173930096-173930118 CTCGCCACTGCTCTCCAGCCTGG - Intronic
1002444905 5:179284423-179284445 CACTGTACTCCACTCCAGCCTGG - Intronic
1002812705 6:648763-648785 CACGCTACTGCTCTCCAGCCTGG - Intronic
1002892286 6:1345695-1345717 CACTCCACTCCACTCCAGCCTGG + Intergenic
1002971923 6:2031737-2031759 CACTCTGCTCCTCAGCTGCCTGG - Intronic
1003051116 6:2782141-2782163 CGCTCTGCTCCTCTGCAGGGTGG - Intronic
1003777550 6:9385834-9385856 CTCACCACTCCACTCCAGCCTGG - Intergenic
1003911090 6:10744517-10744539 CACTCTACTGCACTCCAGCCTGG - Intergenic
1004113914 6:12749008-12749030 CTCTCTACTCCCTTACTGCCAGG - Intronic
1004934632 6:20495505-20495527 CACTCCACTCCACTCCAGCCTGG - Intergenic
1005389593 6:25319810-25319832 CTCTCCACTGCACTCCAGCCTGG - Intronic
1005488969 6:26328508-26328530 CGCGCCACTGCTCTGCAGCCTGG - Intergenic
1005492161 6:26357033-26357055 CACACTACTGCACTGCAGCCTGG - Intergenic
1005778243 6:29161060-29161082 ATCTCAACTCCTCTCCAGCAAGG - Intergenic
1006092537 6:31636543-31636565 TATTCTACTCCTCTGCAGCCTGG + Exonic
1006917229 6:37602428-37602450 CATTCTAATCCTCTGCATCCCGG + Intergenic
1006941114 6:37753069-37753091 CTCTCTACTCTTCTTCACCCAGG + Intergenic
1007151101 6:39692103-39692125 CTCGCCACTGCACTGCAGCCTGG + Intronic
1007412745 6:41674392-41674414 CTCTATACACCTCCGCACCCAGG + Intergenic
1007413461 6:41678548-41678570 CACTCCACTTCTCTCCAGCCAGG + Intergenic
1007535975 6:42589022-42589044 CTCGCTACTGCACTCCAGCCTGG - Intronic
1007576032 6:42925650-42925672 CTGCCTCCTCCTCTGCAGGCTGG + Exonic
1007665371 6:43510232-43510254 CTCCCTCCTTCTCTGCCGCCCGG + Exonic
1007793154 6:44325438-44325460 CGCCCTACTGCTCTCCAGCCTGG - Intronic
1008050199 6:46893294-46893316 ATTTCTTCTCCTCTGAAGCCTGG + Intronic
1008720353 6:54342400-54342422 CGCGCTACTGCTCTCCAGCCTGG - Intronic
1008877105 6:56341135-56341157 CTCTCTTCTCTTCTGGAGCATGG - Intronic
1009794510 6:68450387-68450409 CACTCCACTCCACTCCAGCCTGG - Intergenic
1010004548 6:70981184-70981206 CTCTCCTCTCCTCCACAGCCAGG - Intergenic
1010004580 6:70981284-70981306 CTCTCCTCTCCTCCACAGCCAGG - Intergenic
1010197569 6:73255261-73255283 CTCACTACTGCACTCCAGCCTGG - Intronic
1010866043 6:80977850-80977872 CTCGCCACTGCTCTCCAGCCTGG + Intergenic
1011072923 6:83405537-83405559 CTCACTACTCCTATTCAGCATGG - Intronic
1011626730 6:89289260-89289282 CTCGATACCTCTCTGCAGCCTGG - Intronic
1012949518 6:105503254-105503276 CTCCAGCCTCCTCTGCAGCCTGG + Intergenic
1013332963 6:109124214-109124236 CTTGCTACTCCTCTGCTGCATGG + Intronic
1013416893 6:109933619-109933641 CTCCCTGAGCCTCTGCAGCCAGG - Intergenic
1014260089 6:119206388-119206410 TTCTCTCTTCCTCAGCAGCCTGG - Intronic
1015529050 6:134202602-134202624 CTCGCCACTGCACTGCAGCCTGG + Intronic
1015843005 6:137493317-137493339 CTCCCTCCTCCTTGGCAGCCGGG + Exonic
1016848575 6:148593568-148593590 CTCACTCCTCATCTGGAGCCTGG - Intergenic
1017607383 6:156148398-156148420 CTCACTACTGCACTCCAGCCTGG + Intergenic
1018618611 6:165709720-165709742 CTCTCTACCCCCATGCTGCCAGG + Intronic
1018725529 6:166610237-166610259 CTTTCCACTCCTGAGCAGCCTGG + Intronic
1019104887 6:169660062-169660084 CCCTCTCCTCCACTGCAGCAGGG - Intronic
1019473192 7:1232067-1232089 CTCTCTCCTCCTCTGCGCCCGGG + Intergenic
1019501896 7:1368911-1368933 CGCCCGACTCCTCTGCAGGCGGG - Intergenic
1019696131 7:2447063-2447085 CTCTCCTCTGCTCTGCAGCTGGG - Intergenic
1019722416 7:2581247-2581269 CTCGCCACTGCACTGCAGCCTGG - Intronic
1019768328 7:2867364-2867386 CTTCCTCCTCCCCTGCAGCCTGG + Intergenic
1019980612 7:4619091-4619113 CTCGCTACTGCACTCCAGCCCGG + Intergenic
1020079854 7:5281596-5281618 CCCTCTACTCACCTGTAGCCTGG - Intronic
1020164199 7:5795465-5795487 TGCGCTACTCCTCTCCAGCCTGG + Intergenic
1020217531 7:6205528-6205550 CTCACTACTGCACTCCAGCCTGG + Intronic
1020352175 7:7232898-7232920 CTCTTTCCTCATCTGCAGACGGG + Intronic
1020477035 7:8608369-8608391 CACTCCACTGCACTGCAGCCTGG - Intronic
1020792620 7:12644974-12644996 CACTCCACTCCACTCCAGCCTGG + Intronic
1021270891 7:18584182-18584204 CTCGCTACTGCACTCCAGCCTGG - Intronic
1021392928 7:20116560-20116582 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1021461446 7:20891797-20891819 CCCTCCACTGCACTGCAGCCTGG - Intergenic
1021901333 7:25288692-25288714 ATCTCTACACCTCTGCAACTTGG - Intergenic
1021906922 7:25343571-25343593 CTCTCAAGTCAGCTGCAGCCAGG + Intergenic
1021908912 7:25364622-25364644 CTCACCACTGCTCTCCAGCCTGG - Intergenic
1021993352 7:26157066-26157088 CGCTCTACTGCACTCCAGCCTGG + Intronic
1022196873 7:28076995-28077017 CTTTCTAATGCTCTGCAGCTGGG - Intronic
1022253486 7:28631898-28631920 CTCTCTACTCTTCTGTTGGCAGG - Intronic
1022963984 7:35455883-35455905 CACGCTACTGCACTGCAGCCTGG + Intergenic
1023067104 7:36389404-36389426 CTCACTACTGCACTCCAGCCTGG - Intronic
1023089071 7:36600991-36601013 CACCCTACTCTTCTGCACCCAGG + Intronic
1023441883 7:40193008-40193030 CTCACTACTGCACTCCAGCCTGG - Intronic
1023828513 7:44025553-44025575 CACTCCACTCCACTCCAGCCTGG + Intergenic
1024195514 7:47054562-47054584 CACTCAACTGCTATGCAGCCGGG - Intergenic
1024646193 7:51372869-51372891 CACTCTACTGCACTCCAGCCTGG + Intergenic
1024753376 7:52497158-52497180 CACACTACTACACTGCAGCCTGG - Intergenic
1024989858 7:55224596-55224618 CTCTCTAGTTCTCTGGTGCCTGG + Intronic
1024990839 7:55233622-55233644 CTCCCCACTTCTCTGGAGCCTGG + Intronic
1025037043 7:55600719-55600741 CACTCTACTGCACTCCAGCCTGG + Intergenic
1025199056 7:56950620-56950642 CCCTCTACTCACCTGTAGCCTGG + Intergenic
1025672891 7:63626313-63626335 CCCTCTACTCACCTGTAGCCTGG - Intergenic
1026067059 7:67083989-67084011 CTCTCCACTCCACTCCAACCTGG + Intronic
1026583252 7:71635161-71635183 CTCGCTACTGCACTCCAGCCTGG + Intronic
1026709868 7:72728348-72728370 CTCTCCACTCCACTCCAACCTGG - Intronic
1026767222 7:73167713-73167735 CTCACCACTCCACTCCAGCCTGG - Intergenic
1026782317 7:73276996-73277018 CTCTCCACTGCCCTCCAGCCTGG + Intergenic
1026797060 7:73372994-73373016 CTCGCTACTACACTCCAGCCTGG + Intergenic
1026958076 7:74390622-74390644 CTTGCTACTGCACTGCAGCCTGG + Intronic
1027023079 7:74829842-74829864 CTCTCCACTGCACTCCAGCCTGG + Intronic
1027043691 7:74977422-74977444 CTCACCACTCCACTCCAGCCTGG - Intronic
1027064846 7:75115465-75115487 CTCTCCACTGCACTCCAGCCTGG - Intronic
1027079956 7:75224936-75224958 CTCACCACTCCACTCCAGCCTGG + Intergenic
1028791441 7:94857907-94857929 CGCTCCACTGCACTGCAGCCTGG - Intergenic
1029119108 7:98254364-98254386 CTCACCACTGCACTGCAGCCTGG - Intronic
1029486815 7:100848040-100848062 CTCACCACTGCACTGCAGCCTGG + Intronic
1029756812 7:102578981-102579003 CACTCCACTCCACTCCAGCCTGG + Intronic
1029774751 7:102678050-102678072 CACTCCACTCCACTCCAGCCTGG + Intergenic
1029980564 7:104874888-104874910 CTCACCACTGCTCTCCAGCCTGG - Intronic
1030086214 7:105818211-105818233 CTCTCCACTGCACTCCAGCCTGG - Intronic
1031358890 7:120822726-120822748 CTCTCTCATCCTATGCAGCAGGG + Intronic
1031907832 7:127480277-127480299 CACTCCACTGCTCTCCAGCCTGG + Intergenic
1032079183 7:128850131-128850153 CTCTCTACTCCTCTGCAGCCAGG + Intronic
1032583297 7:133123727-133123749 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1032800267 7:135312169-135312191 CACTGTACTCCACTCCAGCCTGG + Intergenic
1033090462 7:138380808-138380830 CTCGCTACTACACTCCAGCCTGG + Intergenic
1033345318 7:140521781-140521803 CTCCCTACTCATCAGCCGCCTGG + Intronic
1034018540 7:147613797-147613819 CTCGCTACTACACTCCAGCCTGG + Intronic
1034152871 7:148930342-148930364 CGCTCTACTGCACTTCAGCCTGG + Intergenic
1034709728 7:153180621-153180643 CACGCTACTGCACTGCAGCCTGG - Intergenic
1035269549 7:157711478-157711500 GTCTGTGCTCCCCTGCAGCCCGG + Intronic
1035515548 8:229499-229521 GTCTCTACCCCTCAGCAGTCAGG + Intergenic
1035726468 8:1827351-1827373 CTCTCCACTGCACTCCAGCCTGG - Intronic
1036045515 8:5135619-5135641 CTCACCACCCCACTGCAGCCTGG - Intergenic
1036207548 8:6816037-6816059 CTGGGTACTCCTCAGCAGCCTGG - Intronic
1036463606 8:8975419-8975441 CACTCTACTGCACTCCAGCCTGG + Intergenic
1036524439 8:9521687-9521709 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1036555376 8:9855135-9855157 TTCTCCACTGCTCTCCAGCCTGG + Intergenic
1036564913 8:9930394-9930416 CTCTCTTCTCTTCTCCTGCCTGG - Intergenic
1037748274 8:21663335-21663357 CTCCCAGCTCCTCTGCAGTCTGG - Intergenic
1038005061 8:23423151-23423173 CTCCCCACTGCACTGCAGCCTGG - Intronic
1038035732 8:23684683-23684705 CTCTCCACTGCACTCCAGCCTGG - Intergenic
1038187100 8:25285187-25285209 CTCACTACTGCACTCCAGCCTGG - Intronic
1038337262 8:26655593-26655615 CTCTCTTCTCCTCTCCCTCCAGG + Exonic
1038443484 8:27587234-27587256 CTCACTACTGCACTCCAGCCTGG - Intergenic
1038774021 8:30511778-30511800 CGCACCATTCCTCTGCAGCCTGG + Intronic
1038844347 8:31215032-31215054 CTCTCTTCTTCTCTGAAGCCAGG + Intergenic
1038969964 8:32622240-32622262 CTCACTACTACACTCCAGCCTGG + Intronic
1039164724 8:34665186-34665208 CACTCTACTGCACTCCAGCCTGG - Intergenic
1039397998 8:37243863-37243885 CTCTCCTCTCCTCTGCCACCTGG + Intergenic
1039628470 8:39080992-39081014 CACTCTACTGCACTCCAGCCTGG - Intronic
1039966163 8:42285509-42285531 CACTCCACTGCACTGCAGCCTGG + Intronic
1040728388 8:50411402-50411424 CTCTCCACTGCACTCCAGCCTGG + Intronic
1040871128 8:52101000-52101022 CTCTCTTCCCCTCTGCGCCCTGG - Intergenic
1041571727 8:59344755-59344777 CTCTCCACTGCGCTGCAGCCTGG - Intergenic
1041733769 8:61088843-61088865 CTCTCCACTGCACTCCAGCCTGG - Intronic
1041939867 8:63375091-63375113 CGCACTACTGCACTGCAGCCTGG - Intergenic
1042294217 8:67202301-67202323 CACACTACTCCCCTCCAGCCTGG - Intronic
1042449714 8:68930369-68930391 CGCTCCACTCCACTCCAGCCTGG + Intergenic
1042600242 8:70492589-70492611 CTCTCTGCACCTCTGCCTCCTGG + Intergenic
1042784932 8:72536828-72536850 CCCTCTAGTCCAGTGCAGCCGGG + Intergenic
1043640798 8:82447841-82447863 CTCACTACTGCACTCCAGCCTGG + Intergenic
1043856584 8:85272297-85272319 CTCGCCACTCCACTCCAGCCTGG - Intronic
1045004435 8:97905704-97905726 CACGCCACTGCTCTGCAGCCTGG - Intronic
1045082533 8:98643183-98643205 CTCTCCACTGCCCTCCAGCCTGG + Intronic
1045412446 8:101932236-101932258 GGCTTTACTCCTCTGCTGCCTGG - Intronic
1046125835 8:109906178-109906200 CTCACCACTGCACTGCAGCCTGG + Intergenic
1046296722 8:112229470-112229492 CACTCCACTGCACTGCAGCCTGG - Intronic
1046536706 8:115523486-115523508 CACTCTACTGCACTCCAGCCTGG + Intronic
1046611259 8:116428039-116428061 CTGTCTACCCCTCTTCAGACCGG - Intergenic
1046742484 8:117844194-117844216 CTCACCACTGCACTGCAGCCTGG - Intronic
1046820533 8:118629726-118629748 CACACTACTCCCCTCCAGCCTGG + Intergenic
1046847156 8:118930453-118930475 CCCTCTACTGCACTCCAGCCTGG - Intronic
1047097063 8:121637432-121637454 CTCACCACTCCACTCCAGCCTGG - Intronic
1047110008 8:121779042-121779064 CGCGCTACTGCACTGCAGCCTGG + Intergenic
1047209293 8:122828068-122828090 CTCTCCACTGCACTCCAGCCTGG + Intronic
1047424230 8:124730621-124730643 CGCGCTACTGCTCTCCAGCCTGG - Intergenic
1047457184 8:125025642-125025664 CTCACTACTGCACTCCAGCCTGG + Intronic
1047959444 8:130000175-130000197 CTCTCTTCTCCTCAGCACCTGGG - Intronic
1049229271 8:141473642-141473664 CTCACCACTTCACTGCAGCCCGG - Intergenic
1049592380 8:143468536-143468558 CTCTCTCCCCGTCTGCAGCCGGG - Exonic
1049827935 8:144682199-144682221 CTCGCCACTGCACTGCAGCCTGG + Intergenic
1049880051 8:145055815-145055837 CTCTCTCTGCCTCTGCTGCCAGG + Exonic
1049933746 9:480867-480889 CTCTCCAGTCCTCTGCAGTCTGG - Intronic
1050274791 9:3985186-3985208 CTCTTTACTGCACTCCAGCCTGG - Intronic
1050456834 9:5842387-5842409 CTCTCAACTGCACTCCAGCCTGG + Intergenic
1051409193 9:16771123-16771145 CACACTACTGCTCTCCAGCCTGG + Intronic
1051463298 9:17348572-17348594 CACTCCACTGCACTGCAGCCTGG - Intronic
1051805852 9:20991767-20991789 CCCTCCGCTGCTCTGCAGCCTGG + Intronic
1052466396 9:28835796-28835818 TTCTCTACTCCTATGGAGACTGG + Intergenic
1053136472 9:35653602-35653624 CACTCCACTGCACTGCAGCCTGG + Intergenic
1053177932 9:35942802-35942824 TTCTCTGCTCTTCTGCAGTCAGG - Intergenic
1053216867 9:36278830-36278852 CTTGCCACTGCTCTGCAGCCTGG + Intronic
1053251444 9:36577470-36577492 CGCACTACTGCACTGCAGCCTGG + Intronic
1053441187 9:38117764-38117786 CTCTCCAGGCCTCTCCAGCCTGG - Intergenic
1055086980 9:72324251-72324273 CTCGCCACTGCCCTGCAGCCTGG - Intergenic
1055868566 9:80845762-80845784 CTCTCAACTGCACTCCAGCCTGG - Intergenic
1056043464 9:82691677-82691699 CACACTACTGCACTGCAGCCTGG - Intergenic
1056199445 9:84260664-84260686 CTCACCACTGCTCTCCAGCCTGG - Intergenic
1056295422 9:85188470-85188492 CTCTCCAGTCCTCGGTAGCCTGG + Intergenic
1056410322 9:86319874-86319896 CACACTACTGCACTGCAGCCTGG - Intronic
1056937660 9:90929109-90929131 CACTCCACTGCACTGCAGCCTGG + Intergenic
1056943945 9:90977885-90977907 CCCTGTTCTCCTCTGGAGCCTGG - Intergenic
1057117954 9:92543426-92543448 CTCACCACTGCTCTCCAGCCTGG + Intronic
1058159209 9:101549311-101549333 CTCTCTATGCCTCGGCTGCCAGG - Intronic
1058904476 9:109470650-109470672 CGCACCACTGCTCTGCAGCCTGG + Intronic
1059185924 9:112270859-112270881 CACGCTACTGCTCTCCAGCCTGG - Intronic
1059190248 9:112318714-112318736 CCCACTACTGCTCTCCAGCCTGG + Intronic
1059663152 9:116421344-116421366 CACTCTCCTACTCTGCACCCAGG + Intergenic
1059881827 9:118699339-118699361 CGCTCCACTGCACTGCAGCCTGG - Intergenic
1059912077 9:119055549-119055571 CGCACTACTGCACTGCAGCCTGG + Intergenic
1060267057 9:122118035-122118057 TTCTTTTCTCCTCTGCAACCTGG - Intergenic
1060938102 9:127527494-127527516 CTCGCTCCTCCTCTGCAGAATGG - Intronic
1060974566 9:127756971-127756993 CACTCAACTCCACTTCAGCCTGG - Intronic
1061200536 9:129136009-129136031 CTCTCCACTGCACTCCAGCCTGG - Intronic
1061515077 9:131084853-131084875 CTCTCCACTGCACTCCAGCCTGG + Intronic
1061563134 9:131419497-131419519 CTCCAGACTCCTATGCAGCCAGG - Intronic
1061612613 9:131757460-131757482 CTCTCCACTGCACTTCAGCCTGG + Intergenic
1061673463 9:132202276-132202298 CCAGCTCCTCCTCTGCAGCCAGG - Intronic
1061851985 9:133421749-133421771 CTCTCTCCTCCTCTGCGATCAGG - Intronic
1061873886 9:133534564-133534586 CGCTCTGCGCCTCTGGAGCCCGG - Intronic
1061909373 9:133714734-133714756 CGCACCACTGCTCTGCAGCCTGG + Intronic
1062310341 9:135932015-135932037 CTGTCTACTACCCTGCTGCCAGG - Intergenic
1062514256 9:136924516-136924538 CACGCTACTGCACTGCAGCCTGG + Intronic
1062679167 9:137767767-137767789 CTCACTACTGCACTCCAGCCTGG + Intronic
1062686363 9:137815494-137815516 CTTTCTACCCCCCTGAAGCCAGG - Intronic
1185538919 X:886463-886485 CTCTCCACTGCACTCCAGCCTGG + Intergenic
1185573829 X:1154630-1154652 CCCACTACTGCACTGCAGCCTGG - Intergenic
1186096543 X:6108638-6108660 CGCTCTACTGCACTCCAGCCTGG + Intronic
1186106885 X:6216825-6216847 CTCACTACTGCATTGCAGCCTGG - Intronic
1186665982 X:11717885-11717907 CTCACTACTGCACTCCAGCCTGG + Intergenic
1186888725 X:13939144-13939166 CTGATTTCTCCTCTGCAGCCAGG - Intergenic
1187135590 X:16544184-16544206 CACTGTACTCCACTCCAGCCTGG + Intergenic
1187152753 X:16695892-16695914 CTCACTACTGCACTCCAGCCTGG - Intronic
1188298543 X:28480261-28480283 CTCACTACTGCCCTCCAGCCTGG + Intergenic
1188302797 X:28526341-28526363 CTCGCCACTGCTCTCCAGCCTGG - Intergenic
1188790875 X:34406830-34406852 CACTCTACTGCACTCCAGCCTGG - Intergenic
1189080758 X:37969674-37969696 CTCACCACTGCACTGCAGCCTGG - Intronic
1189812699 X:44795145-44795167 CGCCCTACTGCACTGCAGCCTGG + Intergenic
1189822010 X:44878763-44878785 CACTCTACTGCACTCCAGCCTGG - Intronic
1190595888 X:52052414-52052436 CCCTCTTCTCCTCTGTGGCCTGG - Exonic
1190612936 X:52201659-52201681 CCCTCTTCTCCTCTGTGGCCTGG + Exonic
1190833820 X:54082142-54082164 CTCTGCACTCCACTCCAGCCTGG + Intronic
1192123080 X:68475486-68475508 CTCACCACTGCTCTCCAGCCTGG - Intergenic
1193371152 X:80698663-80698685 CGCTCTACTGCACTCCAGCCTGG + Intronic
1193784250 X:85739962-85739984 ATCTCAACTCCTCTCCAGCAAGG + Intergenic
1193864336 X:86711330-86711352 CTCTCCACTGCACTTCAGCCTGG + Intronic
1193912862 X:87327291-87327313 CTCTGTGCTCCTCAGCACCCTGG - Intergenic
1194947760 X:100089851-100089873 CACTCCACTTCTCTCCAGCCTGG + Intergenic
1195077442 X:101340391-101340413 CTCACTACTGCACTCCAGCCTGG + Intergenic
1195334136 X:103832495-103832517 CACTTAGCTCCTCTGCAGCCTGG + Intergenic
1195708279 X:107753957-107753979 CTCACTACTGCACTCCAGCCTGG - Intronic
1195850097 X:109273589-109273611 GTGTCTTCTCCTCTGCAACCAGG + Intergenic
1196098016 X:111820275-111820297 CTCTATATTCCTCTGGTGCCTGG - Intronic
1196390092 X:115197783-115197805 CTCTCTACTACACTCCAGCCTGG + Intronic
1196795286 X:119497289-119497311 CTCACTACTGCACTCCAGCCTGG + Intergenic
1196891885 X:120299351-120299373 CTCACCACTGCTCTCCAGCCTGG - Intronic
1196906685 X:120443935-120443957 CTCGCTACTGCACTCCAGCCTGG + Intronic
1197240544 X:124118575-124118597 CGCACCACTCCTCTCCAGCCTGG + Intronic
1197262473 X:124333448-124333470 CGCTCTGCTGCTCTGTAGCCAGG - Intronic
1197459567 X:126723813-126723835 CTCACCATTCCACTGCAGCCTGG + Intergenic
1197902794 X:131392300-131392322 CTCCTTACTCCTCAGAAGCCTGG + Intronic
1198051402 X:132956416-132956438 CTTTCTTCTACTCTGCACCCGGG - Intronic
1198083980 X:133265684-133265706 CTGTCCCCTCCTCCGCAGCCTGG - Intergenic
1198191615 X:134312573-134312595 CTCTCTACTGCACTCCAGCTGGG - Intergenic
1198408137 X:136336996-136337018 CACTCCACTGCTCTGCAGTCTGG - Intronic
1198716143 X:139559486-139559508 CTCACCACTGCTCTCCAGCCTGG + Intronic
1198812755 X:140552203-140552225 CTCGCTACTGCACTCCAGCCTGG - Intergenic
1199797388 X:151213347-151213369 CGCTCTACTGCACTCCAGCCTGG + Intergenic
1200146864 X:153930847-153930869 CTCTCTAACCCTCTGCCCCCAGG - Exonic
1201012379 Y:9560380-9560402 CTCACTACTGCACTCCAGCCTGG + Intergenic
1201286870 Y:12386948-12386970 CTCCCTTCTTGTCTGCAGCCAGG + Intergenic
1201935290 Y:19405428-19405450 CACTCTGCTCCACTGCTGCCAGG - Intergenic
1202190272 Y:22235199-22235221 CTCGCCACTGCTCTCCAGCCTGG + Intergenic