ID: 1032080081

View in Genome Browser
Species Human (GRCh38)
Location 7:128854333-128854355
Sequence GAGGTTTAACTGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 419}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080073_1032080081 1 Left 1032080073 7:128854309-128854331 CCAGGGCAGGTCTGAGCAGAGGA 0: 1
1: 0
2: 3
3: 49
4: 381
Right 1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG 0: 1
1: 0
2: 0
3: 38
4: 419
1032080071_1032080081 8 Left 1032080071 7:128854302-128854324 CCGAAGGCCAGGGCAGGTCTGAG 0: 1
1: 0
2: 5
3: 38
4: 381
Right 1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG 0: 1
1: 0
2: 0
3: 38
4: 419
1032080070_1032080081 9 Left 1032080070 7:128854301-128854323 CCCGAAGGCCAGGGCAGGTCTGA 0: 1
1: 0
2: 4
3: 35
4: 321
Right 1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG 0: 1
1: 0
2: 0
3: 38
4: 419
1032080069_1032080081 10 Left 1032080069 7:128854300-128854322 CCCCGAAGGCCAGGGCAGGTCTG 0: 1
1: 0
2: 3
3: 29
4: 259
Right 1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG 0: 1
1: 0
2: 0
3: 38
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080081 Original CRISPR GAGGTTTAACTGATGGGGGA GGG Intronic
900319580 1:2075945-2075967 GAGGTTGAACTGTTGGGGGGCGG + Intronic
901753182 1:11424558-11424580 GAGCTTTGACTCATGGTGGAAGG - Intergenic
902087063 1:13871423-13871445 GAGGTCTACTTGATGGGGGAGGG - Intergenic
902150365 1:14438041-14438063 GAAGTTTAACTGGTGGCAGAAGG - Intergenic
904316951 1:29671717-29671739 GAGGTGGCCCTGATGGGGGAGGG + Intergenic
904909507 1:33923396-33923418 GAGCTTTTACTCATGGCGGAAGG - Intronic
906721884 1:48012393-48012415 GAGCTTTCACTCATGGAGGAAGG - Intergenic
907023246 1:51089151-51089173 GAGCTTTTACTCATGGCGGAAGG + Intergenic
907733459 1:57089492-57089514 GAGCTTTTACTCATGGCGGAAGG + Intronic
908741814 1:67336680-67336702 AAGGCCCAACTGATGGGGGATGG + Intronic
909367652 1:74846549-74846571 GAGCTTTAACTCATGGCAGAAGG + Intergenic
910533063 1:88263142-88263164 GAGGTTAGCCTGCTGGGGGATGG + Intergenic
910833822 1:91487276-91487298 GAGCTTTTACTCATGGTGGAAGG + Intergenic
911221097 1:95247823-95247845 TAATTATAACTGATGGGGGAGGG + Intergenic
912191942 1:107351410-107351432 GAGCTTTTACTCATGGTGGAAGG + Intronic
912767875 1:112432643-112432665 AAGGTGTAACTGATGGAGTATGG - Intronic
913051315 1:115119273-115119295 GAGGTTTTACTCATTGTGGAAGG + Intergenic
916218245 1:162417366-162417388 GAGCTTTTACTCATGGTGGAAGG + Intergenic
916559176 1:165918151-165918173 GAGGATATACTGATGGGAGATGG + Intergenic
916734656 1:167597247-167597269 GAGGTTGAAATCATGGCGGAGGG + Intergenic
917641156 1:176984318-176984340 CAATTTTAAGTGATGGGGGATGG + Intronic
919190575 1:194212170-194212192 GAGGCCTAACTGAGGGTGGAAGG + Intergenic
920510506 1:206548323-206548345 GAGGCTTTACTCATGGCGGAAGG + Intronic
921351662 1:214242387-214242409 GAGCTTTTACTCATGGCGGAAGG - Intergenic
921510484 1:216022084-216022106 GAGCTTTTACTCATGGTGGAAGG - Intronic
922006095 1:221532080-221532102 GAGGCTTGACTGAAGAGGGAAGG - Intergenic
922170717 1:223152196-223152218 GAGCTTTTACTCATGGTGGAAGG - Intergenic
923415191 1:233749682-233749704 GAGCTTTTACTCATGGTGGAAGG - Intergenic
924199425 1:241643335-241643357 GAGCTTTTACTCATGGTGGAAGG - Intronic
924287519 1:242503359-242503381 GAGCTTTTACTCATGGTGGAAGG - Intronic
1063052547 10:2468500-2468522 GAGCTTTGACCAATGGGGGATGG + Intergenic
1063558565 10:7104386-7104408 GAGGTCTACTTGATGGGGGAAGG - Intergenic
1063694608 10:8321336-8321358 GAAGCTTAACTGAGGGGTGATGG + Intergenic
1063752259 10:8963606-8963628 GGGGTCTACTTGATGGGGGAAGG + Intergenic
1064199158 10:13270225-13270247 GAGCTTTAACTCATGGTGGAAGG + Intergenic
1064577766 10:16763353-16763375 GAGCTTTTACTCATGGTGGAAGG + Intronic
1064914995 10:20447179-20447201 GAGAATAAACTGATGGGGTATGG - Intergenic
1065341082 10:24706255-24706277 GAGCTTTAAGTGGTGGAGGAGGG - Intronic
1065643927 10:27814883-27814905 GAGGTTGAACTGATAGAGGATGG - Intronic
1069599007 10:69691365-69691387 GAGCTTTATCTGAAGGGGCAGGG - Intronic
1070581490 10:77723692-77723714 GAGCTTTTACTGATGGTGGAAGG - Intergenic
1071380201 10:85051878-85051900 GGGGTCTACTTGATGGGGGAGGG + Intergenic
1072263969 10:93709957-93709979 GTGGTTTCCCTGATGAGGGAGGG + Intergenic
1073939713 10:108682191-108682213 GAGATTTTACTCATGGTGGAAGG + Intergenic
1074582037 10:114728758-114728780 GAGATTTAAGTGATCTGGGAGGG + Intergenic
1074927026 10:118084122-118084144 GAGCTTTAACTCATGGTGGAAGG + Intergenic
1075866219 10:125721444-125721466 GAGTTTTAAGTGAGGGTGGAGGG - Intronic
1077845065 11:6014491-6014513 GAGCTTTTACTTATGGAGGAAGG - Intergenic
1077845303 11:6016234-6016256 GAGATTTTACTCATGGAGGAAGG - Intergenic
1078806551 11:14711506-14711528 GAAGTTTTACTCATGGCGGAAGG + Intronic
1079576895 11:22015482-22015504 GGGGTTTACCTGAGGGTGGAAGG - Intergenic
1079747133 11:24147865-24147887 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1080450995 11:32378837-32378859 GAGGTTTTACTCATGGCTGAAGG - Intergenic
1080577493 11:33613506-33613528 GAGCTTTTACTCATGGTGGAAGG + Intronic
1080603944 11:33848355-33848377 GAGCTTTTACTCATGGCGGAAGG - Intergenic
1081683258 11:45023502-45023524 GAGGTTCAAGGGAAGGGGGAGGG + Intergenic
1081751802 11:45516573-45516595 GAGCTTTTACTCATGGAGGAAGG - Intergenic
1082099428 11:48159866-48159888 GAGGTTTTAGTGATGGCAGATGG + Intronic
1082249426 11:49962378-49962400 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1083068032 11:59945867-59945889 GAGTTTTTACTCATGGCGGAAGG + Intergenic
1084670217 11:70602172-70602194 GAGCTTTTACTCATGGTGGAAGG - Intronic
1084776119 11:71377003-71377025 GAGGTTGAAATAATGGGGAAAGG - Intergenic
1084803757 11:71564935-71564957 GAGGTTTTCCTCATGGTGGAAGG - Intronic
1085375522 11:76057360-76057382 GAGATATCACTTATGGGGGAAGG + Intronic
1085959989 11:81450453-81450475 GAGCTTTTACTCATGGCGGAAGG + Intergenic
1086032024 11:82371305-82371327 GAGGTTTAACTTATGCAGAAAGG - Intergenic
1086418985 11:86619102-86619124 GAGCTTTTACTCATGGTGGAAGG - Intronic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1087301224 11:96438854-96438876 GAGCTTTCACTCATGGTGGAAGG + Intronic
1087510239 11:99083199-99083221 CAAATTTAACTGATGGGAGAAGG - Intronic
1091069573 11:132550472-132550494 GAGCTTTTACTCATGGGGGAAGG - Intronic
1091114566 11:133000999-133001021 GAGATTTTACTCATGGCGGAAGG - Intronic
1092203980 12:6604571-6604593 GAGATGTAGCTGATGGGGGTTGG - Intronic
1094230986 12:28103134-28103156 GAGATTTTACTCATGGCGGAAGG + Intergenic
1094518103 12:31154442-31154464 AAGGTGTACCTCATGGGGGAAGG + Intergenic
1095099845 12:38169141-38169163 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1095409822 12:41909337-41909359 GAGTTTTCACTCATGGTGGAAGG - Intergenic
1096362644 12:51001374-51001396 GGGGTCTACTTGATGGGGGAGGG + Intronic
1096783559 12:54004599-54004621 GAGATTCAAATGATGGGGAAGGG - Intronic
1097557645 12:61159599-61159621 GGGGTCTACTTGATGGGGGAGGG + Intergenic
1098175306 12:67784139-67784161 GAGGTCTAAGTAATGGGGAAAGG - Intergenic
1099990231 12:89713694-89713716 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1100139493 12:91599618-91599640 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1100437415 12:94584337-94584359 GAGCTTTTACTCATGGTGGAAGG - Intronic
1101021321 12:100557223-100557245 GAGCTTTTACTCATGGTGGAAGG + Intronic
1101843850 12:108346247-108346269 GGGTTTTCTCTGATGGGGGAGGG + Intergenic
1102894075 12:116584589-116584611 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1104538098 12:129637592-129637614 GAGCTTTTACTCATGGTGGAAGG - Intronic
1104702995 12:130921415-130921437 GAGCTTTTACTCATGGAGGACGG + Intergenic
1105013797 12:132773798-132773820 GAGGTTTATATAAAGGGGGAGGG - Intronic
1105013825 12:132773914-132773936 GAGGTTTATATAAAGGGGGAGGG - Intronic
1105013833 12:132773948-132773970 GAGGTTTATATAAAGGGGGAAGG - Intronic
1105365641 13:19761902-19761924 GAAGTTTCTCTGAAGGGGGATGG - Intronic
1106439895 13:29757057-29757079 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1106850080 13:33780890-33780912 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1106998144 13:35512254-35512276 GAGGATTACCTGATGGTTGAAGG + Intronic
1107621228 13:42232550-42232572 GTGGGTTAATTGATGGGGAAAGG - Intronic
1108128999 13:47276862-47276884 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1108163429 13:47666740-47666762 GAGGTTGTACTGAAGTGGGAAGG - Intergenic
1108263903 13:48685164-48685186 GAGCTTTTACTCATGGTGGAAGG + Intronic
1109336909 13:61005778-61005800 GAAGCTTAAATCATGGGGGAAGG - Intergenic
1110659177 13:78038633-78038655 GAAGAGTAAGTGATGGGGGAGGG - Intergenic
1111720541 13:91938240-91938262 GAGATTTTACTCATGGTGGAAGG + Intronic
1111813347 13:93119681-93119703 GAGCCTTTACTCATGGGGGAAGG + Intergenic
1112144169 13:96679536-96679558 GAGGTTTAAAGCATGGGTGATGG - Intronic
1112816933 13:103283548-103283570 CAGGTGTAACTGATGAGGAATGG - Intergenic
1112858026 13:103794670-103794692 AAGGTTTAGCTGATGAGGGATGG + Intergenic
1115146784 14:30236049-30236071 GAGGTTTTACTCATGGTGGAAGG + Intergenic
1115297871 14:31850529-31850551 GAAGTTCAACTGATTGGAGAAGG + Intronic
1115715300 14:36097028-36097050 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1116104457 14:40483408-40483430 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1116369924 14:44117404-44117426 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1117058388 14:51935780-51935802 GAGCTTTTACTCATGGCGGAAGG + Intronic
1117092056 14:52261334-52261356 GAGCTTTTACTCATGGAGGAAGG - Intergenic
1117154388 14:52923579-52923601 GAGGTGGAATTCATGGGGGAGGG - Intronic
1117281239 14:54243048-54243070 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1117378789 14:55139340-55139362 GAAGGGGAACTGATGGGGGAGGG + Intronic
1118326068 14:64782049-64782071 GGGGTGTACTTGATGGGGGAGGG + Intronic
1118652961 14:67917324-67917346 GAGCTTTTACTTATGGTGGATGG + Intronic
1118804516 14:69223953-69223975 GAGCTTTTACTCATGGTGGAAGG + Intronic
1118900352 14:69980848-69980870 GAGGTGTGAGTGGTGGGGGATGG + Intronic
1119992708 14:79217250-79217272 GAGGTTTTACTCATGGTGGAAGG + Intronic
1120495304 14:85227171-85227193 TATGTTGAACAGATGGGGGAGGG - Intergenic
1121624964 14:95377170-95377192 GAGCTTTTACTTATGGGGGAAGG + Intergenic
1125274802 15:37978867-37978889 GAGCTTTGACTCATGGTGGAAGG + Intergenic
1126697659 15:51339977-51339999 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1127518940 15:59724073-59724095 GAGATTTAACTCATGGCAGAAGG + Intergenic
1129201764 15:74006774-74006796 TAGGTTTTACTCATGGCGGAAGG + Intronic
1130578509 15:85114818-85114840 GAGGTGAAAATGATGAGGGATGG + Intronic
1131506231 15:93022229-93022251 GAGCTTTTACTCATGGTGGAAGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131899270 15:97069828-97069850 GAGAATCAACTGATGGGGCAGGG - Intergenic
1132194479 15:99901583-99901605 GAGCTTTTACTAATGGTGGAAGG - Intergenic
1132362199 15:101225658-101225680 GAGCTTTTACTCATGGTGGAAGG - Intronic
1133404803 16:5514966-5514988 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1134016339 16:10891153-10891175 GTGGTATCACAGATGGGGGATGG - Intronic
1134037493 16:11042069-11042091 GAATTCTAACTGATGGGGAATGG + Intronic
1136331105 16:29577350-29577372 GGCATTTAACTGGTGGGGGAGGG - Intergenic
1136445750 16:30317097-30317119 GGCATTTAACTGGTGGGGGAGGG - Intergenic
1137341745 16:47614122-47614144 GAGGTTTTCCTCATGGAGGAAGG + Intronic
1137555554 16:49468187-49468209 TAGGTTGAGCTGATGGGGGAAGG + Intergenic
1137854303 16:51778426-51778448 GATGTTAGACTGATGTGGGATGG - Intergenic
1137936341 16:52638624-52638646 GAGCTTTTACTCATGGGGAAAGG + Intergenic
1139805023 16:69557629-69557651 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1141441880 16:84034419-84034441 GAGGTAAGACAGATGGGGGAGGG + Intronic
1144087921 17:11827372-11827394 GAGCTTTTACTGATAGGGGAAGG + Intronic
1144300337 17:13917515-13917537 GAGGTTCAAATGATGAGGCAAGG + Intergenic
1145846412 17:28042259-28042281 CAGGTTGACCTGATTGGGGAGGG - Exonic
1146175127 17:30661214-30661236 GAGCTTTAACTCATGGCAGAAGG + Intergenic
1146348578 17:32077248-32077270 GAGCTTTAACTCATGGCAGAAGG + Intergenic
1146452952 17:32989200-32989222 AAGGTTTTACTCATGGTGGAAGG - Intronic
1147341756 17:39756512-39756534 GGGTTTTGAGTGATGGGGGAGGG + Intergenic
1148559608 17:48598252-48598274 GGGTTTTAGCTGAGGGGGGATGG + Exonic
1148843034 17:50511381-50511403 GAGCTTTAATTGGTTGGGGAGGG - Intronic
1148853529 17:50566308-50566330 GAGGAATAATTGATGGGGGGGGG - Intronic
1149619125 17:58028811-58028833 GAGCTTTTACTCATGGTGGATGG - Intergenic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1150871807 17:68920239-68920261 GGGGTCTACTTGATGGGGGAGGG + Intronic
1151571886 17:74930566-74930588 GAGGTTCAAGTGAGCGGGGACGG + Exonic
1152131454 17:78479442-78479464 TAGGTTTTACCGATGGGAGAGGG + Intronic
1152309007 17:79537874-79537896 GAGGATGAGCTGATGGGGGTGGG + Intergenic
1153082027 18:1238398-1238420 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1153525725 18:5992771-5992793 GAGCTTTTACTCATGGCGGAAGG - Intronic
1156220647 18:35048119-35048141 GAGCTTTCACTCATGGTGGAAGG + Intronic
1156872343 18:41960588-41960610 GAGGGTTAGCGGATGGGGTAGGG + Intronic
1158545093 18:58389309-58389331 GAGCTTGGACTGCTGGGGGAGGG + Intronic
1159594972 18:70374246-70374268 GAGGTTTTTCTGATGATGGAGGG + Intergenic
1160010301 18:75102298-75102320 AAGGTTTTACTCATGGTGGAAGG + Intergenic
1160282489 18:77504648-77504670 AAGGTTTTACTCATGGTGGAAGG - Intergenic
1160558405 18:79740707-79740729 GAGTTTTAACATAAGGGGGAAGG + Intronic
1161611804 19:5247446-5247468 GCTGTTTAACTGCTGTGGGAAGG + Intronic
1162327063 19:10005807-10005829 GAGGTTGACCTGCTGGGGGAGGG + Exonic
1164411967 19:28013810-28013832 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166587150 19:43959667-43959689 GAGCTTTCACTCATGGGAGAAGG - Intronic
1167225581 19:48237217-48237239 GACGTTTAACTCATGGTGGAAGG + Intronic
1167768007 19:51497070-51497092 GAGGGGTAACTGAGGCGGGAGGG + Intronic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168451569 19:56470515-56470537 GAGCTTTAACTGATGGAGCCTGG + Intronic
925061934 2:898056-898078 GAGCTTTGACTCATGGTGGAAGG - Intergenic
926232288 2:11013384-11013406 GAGCTTTTACTCATGGCGGAAGG - Intergenic
926869277 2:17394681-17394703 GAGGTTTACTTGATGGGGCAGGG + Intergenic
929255122 2:39802310-39802332 GAGATTTTACTCATGGAGGAAGG + Intergenic
930726181 2:54683834-54683856 GTGGTTTATCTGATGGGAAAGGG - Intergenic
931198354 2:60074049-60074071 GAGGTTTCTCTGGAGGGGGAGGG + Intergenic
931202866 2:60117037-60117059 GGGGTCTACTTGATGGGGGATGG - Intergenic
931410592 2:62026307-62026329 GAGTTTTTACTCATGGTGGAAGG + Intronic
931854470 2:66287539-66287561 AAGCTTTCACTGATGGTGGAAGG + Intergenic
931892012 2:66683626-66683648 GAGCTCTAACTGCTGGGGGAGGG + Intergenic
931952916 2:67385203-67385225 GAGGTTTTACTCATGGCAGAAGG - Intergenic
932603445 2:73146280-73146302 GAGCTTTTACTCATGGTGGAAGG - Intronic
933196069 2:79391544-79391566 GACTTTCAACTGTTGGGGGATGG + Intronic
933374642 2:81464073-81464095 GAGCTTTTACTCATGGTGGAGGG + Intergenic
933629383 2:84638828-84638850 GAGCTTTTACTCATGGTGGAAGG + Intronic
936775695 2:115970124-115970146 GAGCTTTTACTTATGGTGGAAGG + Intergenic
937081927 2:119146497-119146519 GAGTGTTGAATGATGGGGGAGGG - Intergenic
938017487 2:127879420-127879442 GAGGTTTTACTCATGGCGGAAGG - Intronic
939259123 2:139784122-139784144 GAAGTTTTACTCATGGTGGAAGG + Intergenic
939808429 2:146803791-146803813 GAGCTTTTACTCATGGTGGAAGG + Intergenic
940694507 2:156961548-156961570 GAGCTTTTACTTATGGTGGAAGG + Intergenic
940819339 2:158334843-158334865 GAAGATTAACTAATGGTGGAGGG - Intronic
941370904 2:164662825-164662847 GAGCTTTGACTTATGGCGGAAGG - Intronic
941751768 2:169141986-169142008 CAGTTTTAGCTGATGGGGAAAGG - Intronic
941878241 2:170456445-170456467 GAGGATTAAGAGATGGGGGTTGG + Intronic
942050808 2:172139088-172139110 GGAGTCTACCTGATGGGGGAGGG + Intergenic
942137392 2:172940537-172940559 GAGCTTTTACTCATGGTGGAAGG - Intronic
942597877 2:177609317-177609339 GAGCTTTTACTCATGGTGGAAGG - Intergenic
943587488 2:189758465-189758487 GAGCTTTTACTCATGGCGGAAGG - Intronic
943893391 2:193320806-193320828 GAGCTTTTACTCATGGTGGAAGG - Intergenic
945209490 2:207367491-207367513 GAGCTTTCACTCATGGGGGAAGG - Intergenic
945639957 2:212412484-212412506 GAGCTTTTACTCATGGCGGAGGG - Intronic
947983135 2:234426719-234426741 GAGTGTCAACAGATGGGGGAGGG + Intergenic
947988215 2:234466643-234466665 GAGGCTCCGCTGATGGGGGAGGG + Intergenic
948002190 2:234577380-234577402 GAGCTGTTACTCATGGGGGAAGG + Intergenic
948842525 2:240661182-240661204 GAGCTTTAACTCATGGCAGAAGG + Intergenic
1169519707 20:6357675-6357697 GAGAAATGACTGATGGGGGAAGG + Intergenic
1170121974 20:12921790-12921812 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1173833745 20:46111422-46111444 GAGGCTTGACTGCTGCGGGAGGG + Intergenic
1173958015 20:47049639-47049661 GAGCTTTTACTCATGGCGGAAGG - Intronic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1176864773 21:14041011-14041033 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1176982320 21:15397552-15397574 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1178203287 21:30432908-30432930 GAGATTGGACTGAAGGGGGATGG + Intergenic
1178766046 21:35451871-35451893 GAGCTTTCACTCATGGTGGAAGG + Intronic
1179579182 21:42329298-42329320 GGGGTTTATCTGGTGAGGGATGG + Intergenic
1180536148 22:16394462-16394484 AAGCATTAACTGGTGGGGGAGGG + Intergenic
1180643276 22:17316907-17316929 GAGCTTTTACTCATGGCGGAAGG + Intergenic
1180655039 22:17413141-17413163 GAGGGTTATCTGATGGGGAATGG + Intronic
1181031892 22:20152332-20152354 GAGGGTTAACTGACGGCTGATGG - Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1183275938 22:36897814-36897836 GAGCTTTTACTCATGGAGGAAGG - Intergenic
1183391478 22:37547684-37547706 GAGGTTAATGTCATGGGGGAAGG + Intergenic
1184132077 22:42522844-42522866 GAGCTTTGACTCATGGTGGAAGG - Intergenic
1184800650 22:46756829-46756851 GAGCTTTTACTCATGGTGGAAGG + Intergenic
949113551 3:292714-292736 GAGCTTTTACTCATGGTGGAAGG + Intronic
951475393 3:23100322-23100344 GAGTTTTTACTCATGGCGGAAGG + Intergenic
951531002 3:23698094-23698116 GAGTTTCAACTTATGGGGGTGGG - Intergenic
951934157 3:28003033-28003055 GAGCTTTTACTCATGGTGGAAGG + Intergenic
952387855 3:32855759-32855781 GTGGTTTAAGTGGTGAGGGAAGG + Intronic
952784855 3:37143082-37143104 GAGCTTTTACTCATGGTGGAAGG - Intronic
953066800 3:39480621-39480643 GAGGTTTAACTAGAGGGTGAAGG - Intronic
953706634 3:45236108-45236130 GAGTTTTTACTCATGGTGGAAGG - Intergenic
953959895 3:47258710-47258732 GAGCTTTTACTCATGGTGGAAGG - Intronic
954474973 3:50735860-50735882 GAGCTTTTACTCATGGCGGAAGG + Intronic
954758412 3:52856032-52856054 GAGACTTTACTGATGGGGGACGG + Intronic
954897182 3:53985726-53985748 GAGCTTTGACTCATGGTGGAAGG - Intergenic
955364712 3:58301071-58301093 GTGGACTGACTGATGGGGGAAGG - Intergenic
955814274 3:62825512-62825534 GAGGTTTACCTGATAGAAGACGG - Intronic
957335182 3:78818594-78818616 GAGGCTGAACTGGTGGGGCAAGG + Intronic
957562413 3:81839645-81839667 TAGTCTTAACTCATGGGGGAGGG + Intergenic
957891565 3:86365435-86365457 GAGCTTTTACTTATGGAGGAAGG - Intergenic
958036782 3:88179415-88179437 GAGATTTAATGGATGGGGGATGG + Intergenic
960014404 3:112870736-112870758 GAGCTTTTACTCATGGTGGAAGG + Intergenic
960034228 3:113086679-113086701 GAGGCTCAGCTGATGGGGCATGG + Intergenic
960111951 3:113853857-113853879 GAGGCTTAAATGATGGGGGCGGG + Intronic
960150524 3:114244623-114244645 GAGCTTTTACTCATGGTGGAAGG - Intergenic
960607199 3:119518788-119518810 GCTGTTAAACTGATGGGGGGAGG - Intronic
960959722 3:123061762-123061784 GAGCTTTTACTCATGGTGGAAGG + Intergenic
961219484 3:125188256-125188278 AAGCTTTCACTCATGGGGGAAGG - Intronic
962247884 3:133812683-133812705 AATGTTTAAAAGATGGGGGAGGG - Intronic
962657695 3:137565453-137565475 GAGCTTTTACTCATGGTGGAAGG - Intergenic
963053488 3:141162946-141162968 GGGGTCTATTTGATGGGGGAGGG + Intergenic
964487054 3:157196924-157196946 GGGGTCTACTTGATGGGGGAGGG + Intergenic
965044954 3:163564948-163564970 GAGCTTTAGCTCATGGGAGATGG + Intergenic
965805366 3:172536335-172536357 GAGCTTTTACTCATGGGAGAAGG - Intergenic
965979798 3:174674102-174674124 GAGCTTTAACTCATAGTGGAAGG + Intronic
965990561 3:174812019-174812041 GAGCTTTTACTCATGGTGGAAGG - Intronic
966983851 3:185162046-185162068 GAGGGTTGAATGATGGGGGTAGG + Intergenic
969972020 4:11057644-11057666 GTGTTTTCACTGCTGGGGGAAGG + Intergenic
970744251 4:19275961-19275983 GAGCTTTTACTCATGGGGGAAGG - Intergenic
972227113 4:37026252-37026274 GAGCTTTTACTCATGGCGGAAGG + Intergenic
972976510 4:44642794-44642816 GAGCTTTTACTCATGGTGGAAGG - Intronic
973614509 4:52665260-52665282 AAGCTTTAACTCATGGCGGAAGG + Intergenic
973651655 4:53002878-53002900 GAGCTTTTACTCATGGCGGAAGG + Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974447604 4:62006431-62006453 GAGGTTTCACTTTTGGGGGTAGG + Intronic
974666953 4:64974626-64974648 GAGGTTTATCACATGGGTGAAGG - Intergenic
974854127 4:67439027-67439049 AAAGTCTAACTAATGGGGGATGG + Intergenic
975113243 4:70650186-70650208 GTGGTTTAACAGATGAGGAATGG - Intronic
975131708 4:70838803-70838825 GAGATTTAGCTGTTGGGGGGAGG - Intronic
975244182 4:72099509-72099531 GAGTTTTTACTCATGGTGGAAGG + Intronic
975435440 4:74345669-74345691 GAGGTTTGACTTATAGTGGAAGG + Intergenic
976045485 4:80941761-80941783 GAGCTTTCACTCATGGTGGAAGG + Intronic
977071414 4:92393042-92393064 GAGCTTTTACTCATGGGGGAAGG + Intronic
978100787 4:104839002-104839024 GAGCTTTTACTCATGGTGGAAGG - Intergenic
978484064 4:109229947-109229969 GAGCTTTTACTCATGGTGGAAGG + Intronic
978683254 4:111409167-111409189 GGGGTCTACTTGATGGGGGAGGG - Intergenic
979549138 4:121970678-121970700 GAGGTGCAACTGATGGGAGCTGG - Intergenic
979603004 4:122606666-122606688 GAGCTTTTACTCATGGTGGAAGG - Intergenic
980658038 4:135815380-135815402 GAGCTTTAACTCATGGGAGAAGG - Intergenic
980775609 4:137432008-137432030 GAGCTTTTACTCATGGGAGAAGG - Intergenic
981053185 4:140331951-140331973 GAGCTTTTACTCATGGTGGAAGG + Intronic
982566731 4:156995988-156996010 GAGCTTTAACTCATGGTGGATGG + Intergenic
982566996 4:156997982-156998004 GAGCTTTTACTCATGGTGGAAGG + Intergenic
983585296 4:169348063-169348085 GAGGTTTTACTCATGGCAGAAGG + Intergenic
984074609 4:175159858-175159880 GAGATTTACCTCATGGTGGAAGG - Intergenic
984946952 4:184976344-184976366 GAGGTCTACTTGAAGGGGGAGGG - Intergenic
985159208 4:187026704-187026726 AAGCTTTAACTCATGGTGGAAGG + Intergenic
986510688 5:8503471-8503493 GAGCTTTTACTCATGGGGGAAGG + Intergenic
986934534 5:12866755-12866777 GAGTTTTTACTCATGGTGGAAGG - Intergenic
987264913 5:16243261-16243283 GAGCTTTTACTGATGGTGGAAGG - Intergenic
987910565 5:24138906-24138928 GTGCTTTTACTCATGGGGGAAGG - Intronic
988096150 5:26613198-26613220 GAGGTCTAACTGATGCAGCATGG - Intergenic
988782043 5:34531070-34531092 GGGGTCTACTTGATGGGGGAGGG + Intergenic
988791309 5:34610355-34610377 GAGCTTTGACTCATGGTGGAAGG - Intergenic
989393403 5:40925749-40925771 GAGATTTTACTCATGGCGGAAGG + Intronic
990498324 5:56370500-56370522 GAGCTTTTACTCATGGTGGAAGG - Intergenic
991600875 5:68350373-68350395 GAGGTTTTACTCATGGCGGAGGG + Intergenic
992682495 5:79167010-79167032 GAGCTTTTACTCATGGTGGAAGG - Intronic
993388756 5:87291761-87291783 GAGCTTTTACTCATGGTGGAAGG - Intronic
994100083 5:95882472-95882494 GAGCTTTTACTTATGGTGGAAGG + Intergenic
995460769 5:112400477-112400499 GAGCTTTTACTGATGGTGGAAGG + Intronic
996284120 5:121769061-121769083 GAGCTTTCACTCATGGCGGAAGG - Intergenic
997183661 5:131859571-131859593 GAGCTTTTACTCATGGTGGAAGG - Intronic
997330533 5:133057995-133058017 GAGGCTAAACTGATGAGGAAAGG + Intronic
998327158 5:141291372-141291394 GAGCTTTAACTCATGGCAGAAGG + Intergenic
998552471 5:143090673-143090695 CTGGGTTAGCTGATGGGGGAGGG + Intronic
998918182 5:147039129-147039151 GAGGCTTGACTGATGGGAAAGGG - Intronic
999571435 5:152924372-152924394 GAGCTTTTACTTATGGTGGAAGG - Intergenic
999659357 5:153842772-153842794 AAGCTTTTACTCATGGGGGAAGG - Intergenic
1000269875 5:159673760-159673782 GAGCTTTGACTCATGGTGGAAGG - Intergenic
1004209208 6:13620779-13620801 GAGGTTTAAAAGACGGTGGATGG + Exonic
1004603316 6:17171456-17171478 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1004804196 6:19184156-19184178 GAGCTTTTACTTATGGTGGAAGG - Intergenic
1005483506 6:26277083-26277105 GAGATTTTACTCATGGCGGAAGG + Intergenic
1005597484 6:27393397-27393419 GAGCTTTTACTCATGGTGGAAGG - Intronic
1005680211 6:28199312-28199334 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1007502449 6:42308773-42308795 GAGGTCTACTTGAGGGGGGAGGG + Intronic
1008801969 6:55379316-55379338 GGGGTCTCCCTGATGGGGGAGGG - Intronic
1008974723 6:57411188-57411210 GAGCTTTTACTGATGGAGGAAGG - Intronic
1009163610 6:60312694-60312716 GAGCTTTTACCGATGGAGGAAGG - Intergenic
1010095966 6:72046323-72046345 GAGATTTTATTGTTGGGGGAAGG + Intronic
1010988138 6:82449725-82449747 GAGTTTTAAATCATGGTGGAAGG + Intergenic
1011540684 6:88424627-88424649 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1011645623 6:89455332-89455354 GAGCTTTTACTCATGGTGGAAGG + Intronic
1011845762 6:91561519-91561541 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1013541122 6:111110431-111110453 AAGGTCTAATTGATGGGGTAAGG + Intronic
1013657509 6:112260953-112260975 GAGTCTGAACTGATGGGAGAAGG + Intergenic
1013864453 6:114678473-114678495 GGGGTCTACTTGATGGGGGAGGG + Intergenic
1014893675 6:126873194-126873216 GAGCTTTTACTCATGGTGGAGGG - Intergenic
1015218984 6:130782490-130782512 GAGTTTTTACTCATGGTGGAGGG - Intergenic
1015288848 6:131515016-131515038 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1015365217 6:132389558-132389580 GTGCTTTGACTGGTGGGGGATGG + Intronic
1016564257 6:145435027-145435049 GAGCTTTTACTTATGGTGGAAGG - Intergenic
1016740927 6:147527912-147527934 GAGATTTTACTCATGGTGGAAGG + Intronic
1017392594 6:153957839-153957861 GAGGTTTTACTCATGGCAGAAGG + Intergenic
1017812892 6:157996819-157996841 GAGCTTTTACTCATGGTGGAAGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018771537 6:166975310-166975332 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1020677763 7:11201216-11201238 AAGCTTTAACTCATGGAGGAAGG + Intergenic
1021642860 7:22756911-22756933 GAGGTAAAATTGATGAGGGATGG + Intergenic
1022327728 7:29347271-29347293 GAAGTTGAACTGCTGGGTGAAGG - Intronic
1023512817 7:40971135-40971157 GAGCTTTCACTGATGGCAGAAGG + Intergenic
1023603378 7:41903306-41903328 GAGGTTTGACTGATCTGGGCTGG - Intergenic
1023839065 7:44085762-44085784 GAGGTATACCTGCTGGAGGAGGG + Intergenic
1024059708 7:45688868-45688890 GAGTGTTAACTGATGGGGATGGG - Intronic
1024167557 7:46749964-46749986 GAGCTTATACTGATGGTGGAAGG + Intronic
1024355353 7:48408847-48408869 GAGGTCTACCAGATGGTGGAGGG - Intronic
1024886748 7:54150969-54150991 GAGGTTGAAAAGATGAGGGATGG - Intergenic
1027210496 7:76142975-76142997 GAGTTGCAACTGATGGGGGTTGG + Intergenic
1027342142 7:77220991-77221013 GAGCTTTTACTCATGGCGGAAGG + Intronic
1027935803 7:84600426-84600448 GAGCTTTCACTCATGGTGGAAGG - Intergenic
1028933186 7:96437481-96437503 GAGATTTGACTCATGGTGGAAGG + Intergenic
1029510529 7:100991962-100991984 GAGCCTGAACTGATGGGTGAGGG - Exonic
1029704451 7:102268730-102268752 GAGGCTTTACTCATGGTGGAAGG + Intronic
1030349217 7:108464476-108464498 GGGGTCTACTTGATGGGGGAGGG + Intergenic
1030577985 7:111314036-111314058 GAGCTTTTACTCATGGTGGAAGG - Intronic
1030834352 7:114264775-114264797 GAGCTTTTACTCATGGGGGAAGG + Intronic
1031241928 7:119256758-119256780 GAGGTTTAAATGATGGGAAATGG - Intergenic
1031762272 7:125728669-125728691 GAGGAATATCAGATGGGGGAGGG + Intergenic
1032080081 7:128854333-128854355 GAGGTTTAACTGATGGGGGAGGG + Intronic
1033579526 7:142719329-142719351 TAGGTTTACCTGATGGGGTTGGG - Intergenic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034621053 7:152457387-152457409 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1035006258 7:155663389-155663411 GAGCTTTTACTCATGGTGGAAGG + Intronic
1036202008 8:6777884-6777906 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1036779652 8:11637003-11637025 GAGAGTTATCTGAGGGGGGAGGG + Intergenic
1037480459 8:19300572-19300594 GAGCTTTTACTCATGGCGGAAGG + Intergenic
1037638536 8:20722088-20722110 GAGATTTTACTGATGGCAGAAGG + Intergenic
1038523528 8:28253847-28253869 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1039413076 8:37371865-37371887 GAGGTTTAGATGAGGGGAGATGG + Intergenic
1041510486 8:58649763-58649785 GAGCTTTTACTCATGGTGGAAGG - Intronic
1042547027 8:69960131-69960153 GGGGGTTAACTGGTGGTGGAGGG - Intergenic
1042749231 8:72140004-72140026 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1043102384 8:76061712-76061734 GAGCTTTAACTCATGGCAGAAGG - Intergenic
1043480265 8:80645661-80645683 GAGCTTTTACTCATGGTGGAAGG - Intronic
1043721867 8:83554740-83554762 GAGTTTTTACTCATGGTGGAAGG - Intergenic
1044515776 8:93136741-93136763 GAGCTTTTACTCATGGTGGAAGG + Intronic
1044596375 8:93962674-93962696 GAGCTTTTACTAATGGTGGAAGG + Intergenic
1045236095 8:100353728-100353750 GAGCTTTAACTTATGATGGAAGG + Intronic
1045437151 8:102174713-102174735 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1046716041 8:117568526-117568548 GAGCTTTCACTCATGGTGGAAGG + Intergenic
1046793292 8:118344214-118344236 CAGGTTGAACTAATGTGGGAAGG + Intronic
1047171098 8:122492974-122492996 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1047189178 8:122662236-122662258 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1048127698 8:131655755-131655777 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1048130555 8:131692886-131692908 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1048280232 8:133100325-133100347 GAGGTTTGAGTGCTGGGGTAGGG - Intronic
1048471873 8:134711530-134711552 GAGGTTTACCTGAGGGCGGGAGG + Intronic
1048500595 8:134971195-134971217 GAGCTTTTACTCATGGCGGAAGG - Intergenic
1048946867 8:139456776-139456798 GAGGTTGTAGTGATGGGGAAAGG - Intergenic
1050496560 9:6248487-6248509 GAGGATCATCTGATGGTGGAAGG - Intronic
1052094603 9:24369258-24369280 TAGGTGGGACTGATGGGGGATGG + Intergenic
1052577664 9:30311183-30311205 GAGCTTTTACTAATGGTGGAAGG + Intergenic
1052768447 9:32665659-32665681 GAGCTTTTACTAATGGTGGAAGG + Intergenic
1053284470 9:36841418-36841440 GAAGTTTAACAGATGGGAAAAGG - Intronic
1055089477 9:72348121-72348143 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1055699274 9:78924806-78924828 GAGGTTTATTGGATGGCGGAGGG - Intergenic
1055794805 9:79964374-79964396 GATATTAAACTGATGTGGGATGG - Intergenic
1056181372 9:84086161-84086183 GGGGTCTACTTGATGGGGGAGGG - Intergenic
1057937491 9:99253107-99253129 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1059617694 9:115968521-115968543 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1059975598 9:119713528-119713550 GGGGTTTACCTCAAGGGGGAGGG - Intergenic
1060329983 9:122659378-122659400 CAGGTGGAAGTGATGGGGGAGGG - Intergenic
1060561554 9:124549136-124549158 GAGGGTTATCTGGTGGGGGATGG + Intronic
1060774105 9:126356860-126356882 GAGCTTTTACTCATGGAGGAAGG - Intronic
1062144736 9:134982750-134982772 GAGGTTGTACTGAGGGGGGGTGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1187083337 X:16014972-16014994 GAGCTTTGACTCATGGTGGAAGG + Intergenic
1187561527 X:20407930-20407952 GAGCTTTAACTCATGGCAGAAGG + Intergenic
1187791006 X:22950302-22950324 GAATCATAACTGATGGGGGATGG - Intergenic
1187795798 X:23002910-23002932 GGGGTCTAGCTGATGGGGGAGGG - Exonic
1188621163 X:32225779-32225801 GAGCTTTTACTCATGGTGGAAGG - Intronic
1188734886 X:33700854-33700876 GAGCTTTAGGTGATGGGGTATGG + Intergenic
1188890130 X:35600342-35600364 AAACTTTAACTGGTGGGGGATGG - Intergenic
1189016839 X:37293941-37293963 GAGCTTTTACTCATGGTGGAAGG + Intergenic
1189070298 X:37856469-37856491 GAGCTTTTACTCATGGTGGAAGG + Intronic
1189220041 X:39363724-39363746 GGGGTGTACTTGATGGGGGAGGG + Intergenic
1189547401 X:42055957-42055979 GAGCTTTTACTCATGGAGGAAGG + Intergenic
1189809067 X:44764181-44764203 GAGGAAGAAGTGATGGGGGAGGG - Intergenic
1190862317 X:54357105-54357127 GAGGTTCAGCTGATGTGTGAGGG - Intronic
1192706821 X:73534686-73534708 GAGGTTTTACTCATGGCAGAAGG - Intergenic
1192836840 X:74808839-74808861 GAGCTTTAACGGCTGGAGGAGGG + Intronic
1193282360 X:79668534-79668556 GAGCTTTTACTCATGGCGGAAGG + Intergenic
1193634366 X:83930186-83930208 GAGCTTTCAATCATGGGGGAAGG + Intergenic
1193704246 X:84801738-84801760 AAGCTTTTACTCATGGGGGAAGG - Intergenic
1194961663 X:100243335-100243357 GAGCTTTTACTCATGGCGGAAGG + Intergenic
1195300159 X:103521788-103521810 GAGCTTTAACTCATGGCGAAAGG + Intergenic
1195443103 X:104920584-104920606 GAGCTTTTACTCATGGTGGAAGG - Intronic
1196231301 X:113225812-113225834 GAGATTTTACTCATGGTGGAAGG + Intergenic
1196278911 X:113799791-113799813 GAGGTTTTACTCATGGCTGAAGG - Intergenic
1196837937 X:119830456-119830478 GAGCTTTTACTCATGGTGGAAGG - Intergenic
1196838326 X:119833903-119833925 GAGCTTTAACTCATGGCAGAAGG - Intergenic
1197982048 X:132227464-132227486 GAGCTTTTACTTATGGTGGAAGG + Intergenic
1198169273 X:134089897-134089919 GAGGTTTTACTCATTGTGGAAGG + Intergenic
1198197134 X:134373930-134373952 GAGGGCTAACTCTTGGGGGAGGG + Intronic
1198682859 X:139201386-139201408 GAGCCCTAACTGATGGGGGTGGG + Intronic
1199393194 X:147305871-147305893 GAGTTCTGACTGATGGGGGTGGG - Intergenic
1199950653 X:152703331-152703353 GAAGTTTAACAAATGGCGGATGG - Intergenic
1199959029 X:152765130-152765152 GAAGTTTAACAAATGGCGGATGG + Intergenic
1200423727 Y:2999802-2999824 GAGCTTTAACTCATGGCAGAAGG + Intergenic
1201787466 Y:17801440-17801462 GAAGTTTAACAGATTGGGGCAGG + Intergenic
1201814087 Y:18104548-18104570 GAAGTTTAACAGATTGGGGCAGG - Intergenic
1202275086 Y:23109649-23109671 GAGGTTTAAGGGATGGCTGAGGG - Intergenic
1202290942 Y:23311040-23311062 GAGGTTTAAGGGATGGCTGAGGG + Intergenic
1202428077 Y:24743371-24743393 GAGGTTTAAGGGATGGCTGAGGG - Intergenic
1202442714 Y:24926720-24926742 GAGGTTTAAGGGATGGCTGAGGG + Intergenic