ID: 1032080607

View in Genome Browser
Species Human (GRCh38)
Location 7:128856693-128856715
Sequence CCTTCTGGGGAGGGGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 1, 1: 1, 2: 11, 3: 95, 4: 799}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080597_1032080607 -8 Left 1032080597 7:128856678-128856700 CCTTCCGGGCTGGGGCCTTCTGG 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080595_1032080607 -1 Left 1032080595 7:128856671-128856693 CCAACTCCCTTCCGGGCTGGGGC 0: 1
1: 0
2: 3
3: 33
4: 261
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080586_1032080607 9 Left 1032080586 7:128856661-128856683 CCTGCCCCTGCCAACTCCCTTCC 0: 1
1: 1
2: 11
3: 129
4: 1222
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080590_1032080607 4 Left 1032080590 7:128856666-128856688 CCCTGCCAACTCCCTTCCGGGCT 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080596_1032080607 -7 Left 1032080596 7:128856677-128856699 CCCTTCCGGGCTGGGGCCTTCTG 0: 1
1: 0
2: 1
3: 22
4: 210
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080591_1032080607 3 Left 1032080591 7:128856667-128856689 CCTGCCAACTCCCTTCCGGGCTG 0: 1
1: 0
2: 0
3: 18
4: 468
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080589_1032080607 5 Left 1032080589 7:128856665-128856687 CCCCTGCCAACTCCCTTCCGGGC 0: 1
1: 0
2: 1
3: 25
4: 327
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799
1032080585_1032080607 10 Left 1032080585 7:128856660-128856682 CCCTGCCCCTGCCAACTCCCTTC 0: 1
1: 0
2: 5
3: 76
4: 846
Right 1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG 0: 1
1: 1
2: 11
3: 95
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080607 Original CRISPR CCTTCTGGGGAGGGGAAGGA TGG Intronic
900100067 1:958609-958631 AGTGCTGGGGAGGGAAAGGAAGG - Intronic
900142604 1:1144936-1144958 CCTCCTGGGGGTGGGAAGGGAGG - Intergenic
900192836 1:1358688-1358710 CCTGCTGGGGAGGGGCAGTGTGG + Intronic
900237828 1:1600887-1600909 CCGACGGGGGAGGGGAAGGCGGG + Intergenic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
900426971 1:2585393-2585415 CCATCTGGGGCTGGGCAGGAAGG - Intergenic
900483981 1:2912800-2912822 CAGGCTGGGGAGGGGAGGGAAGG + Intergenic
900794586 1:4700421-4700443 TCCTCTGGGGTGGGGGAGGAGGG - Intronic
901013093 1:6211904-6211926 CCTACTGGGGAGGGGCAGTGGGG - Exonic
901044479 1:6387543-6387565 CCTCCTGGGGAGGGGGATCAAGG - Intronic
901230815 1:7640879-7640901 CCGGCTGGGGAGGGAAAGTATGG + Intronic
901640637 1:10691374-10691396 CCTTCTCAGGAGGGGACAGAAGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
901746117 1:11374846-11374868 CCATCTGGGGAGGACAAGGAGGG + Intergenic
901775732 1:11559532-11559554 CGTTCTGGGGAGGGGGGGCAAGG - Intergenic
901856678 1:12048943-12048965 GCTTCTGGGGAGGTCAAGGCAGG - Intergenic
902169064 1:14596190-14596212 ACTTGTGGGTGGGGGAAGGAGGG - Intergenic
902364579 1:15963504-15963526 CCCTCTGGGGATGGGGTGGAGGG - Intronic
902470053 1:16642974-16642996 TCTTGTTGGGAGGAGAAGGAAGG - Intergenic
902696173 1:18142532-18142554 CCATCTGGGAAGGGGCAGGGAGG - Intronic
902785954 1:18732859-18732881 CATCCTGGGGATGGGCAGGAGGG + Intronic
903123949 1:21235381-21235403 GTTTCTGGGGAGGTGGAGGAGGG + Intronic
903180235 1:21601615-21601637 CAGGCAGGGGAGGGGAAGGACGG + Intronic
903360144 1:22772020-22772042 CTTGCTGGGGAAGGGAAAGAAGG - Intronic
903542549 1:24105128-24105150 CCTTCCTGGGAGGGGAACCATGG - Intronic
903554119 1:24180825-24180847 CATTCTGGGGAGGGGCCAGACGG + Exonic
903621371 1:24700757-24700779 CATTCTGGGGCTGAGAAGGAGGG - Intergenic
903735818 1:25529588-25529610 CCTGCTGGGAAGGGAGAGGAGGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903820946 1:26102176-26102198 GCTTCTGTGGAGGGGAATGGCGG - Intergenic
904031466 1:27536096-27536118 CCTGCTGGTGTGGGGGAGGACGG - Intronic
904599104 1:31664140-31664162 GGTCCTGGGGAGGGGAAGGAAGG + Intronic
904713264 1:32447768-32447790 CCCTAGGGGAAGGGGAAGGAGGG - Intergenic
905166092 1:36084225-36084247 CATCCTGCGGAGGGGAAGAAAGG + Intronic
905166227 1:36084676-36084698 CCGCCTGGGGACGGGAGGGAGGG + Intronic
905335216 1:37240257-37240279 CCCTCTGGGGAGGGGAGAGAGGG + Intergenic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906078772 1:43070057-43070079 CCATCTGGGGAGTGGTGGGAGGG - Intergenic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906152770 1:43597749-43597771 CCTTCTGGGGAGGGGCGGAGGGG - Exonic
906475446 1:46166622-46166644 GCTTCTGGGGACCGGAAGGAGGG - Intronic
906576281 1:46893284-46893306 ACTACTGGGGTGGGGGAGGAAGG + Intergenic
906595640 1:47074303-47074325 ACTACTGGGGTGGGGGAGGAAGG - Intronic
906865087 1:49409421-49409443 ACTTTTGGGGAGGGGAAGGAAGG + Intronic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907406898 1:54259161-54259183 TCTTCTGGGGCGGGGTAGGGGGG - Intronic
907564826 1:55425061-55425083 CCTTATGGGAAAAGGAAGGAAGG - Intergenic
907852350 1:58267626-58267648 TCTCCTGGGATGGGGAAGGATGG + Intronic
908474219 1:64471771-64471793 CCTCCTCGGGAGAGGAAGGAGGG + Intronic
909752080 1:79174615-79174637 ACTTCTTGGAAGGGGAAGGTAGG + Intergenic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
910213594 1:84819085-84819107 CCTTATGCTGACGGGAAGGAAGG - Intronic
910262054 1:85302523-85302545 CCTTCAGCAGATGGGAAGGAGGG + Intergenic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
911514117 1:98846255-98846277 CCTGCTTGGGAGTGCAAGGAGGG - Intergenic
911665032 1:100542280-100542302 CCTTTTGGGGTGGGGCTGGAGGG + Intergenic
912490516 1:110060265-110060287 GCTGGTGGGGAGGGGAAGCAGGG + Exonic
912735324 1:112145097-112145119 CCAGCTGGGCAGGGGGAGGATGG + Intergenic
913436178 1:118849963-118849985 ACTTCTGGGGATGGGAAAAAAGG + Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
916336084 1:163672677-163672699 TCTACTGGGGAGGGGAAAGGTGG - Intergenic
917102395 1:171459458-171459480 GCTTCTGGGGAGGTTAAGGTGGG + Intergenic
917356466 1:174131355-174131377 CTCCCTGGGCAGGGGAAGGATGG - Intergenic
917472864 1:175340896-175340918 CCTACTGGGAAAGGGAAAGAGGG - Intronic
918014040 1:180615565-180615587 CCATCTTGGGCTGGGAAGGAGGG + Intergenic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
919586651 1:199448025-199448047 CTTCCTGGGCAGGGGAAGGGCGG - Intergenic
919809250 1:201398827-201398849 CCCTCTTGGGAGGGGGAGCAGGG - Intronic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920284704 1:204871057-204871079 CCTTCAGGAGAGAGGTAGGATGG + Intronic
920291854 1:204929106-204929128 CCTCCTGGGGATGGGGTGGAGGG - Intronic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920384618 1:205561689-205561711 CCTACAGGGGAGGGGAGGGGAGG + Intergenic
920631730 1:207659280-207659302 CCCTCTGCAGAGGGGAAGGAAGG - Intronic
920642220 1:207763396-207763418 CCCTCTGCAGACGGGAAGGAAGG - Intronic
920702303 1:208226831-208226853 CCTTTGGGGGAGGGTCAGGAAGG + Intronic
921566812 1:216731356-216731378 TCTTATGGGGAGAGGAAGAAGGG + Intronic
921736434 1:218633682-218633704 GCTCCTGGGGCGGGGAAGGGTGG - Intergenic
922443737 1:225678641-225678663 CCCTCTGGGGAGGATAAGGCAGG - Intergenic
922732856 1:227960550-227960572 CAATTTGAGGAGGGGAAGGAAGG + Intergenic
922796690 1:228343040-228343062 CCTGCTGGGGAGGGCCAAGAGGG + Intronic
923114599 1:230923342-230923364 CCATCTGGGGAGGGCAAGTCAGG - Intronic
923319703 1:232818954-232818976 CCTTTTGGGAAGGGTCAGGACGG - Intergenic
923457225 1:234174951-234174973 CCTCCTGGGGACAGGAAGGGAGG + Intronic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
924385485 1:243495404-243495426 CCTGCGGTGGAAGGGAAGGAGGG + Intronic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1063918633 10:10909720-10909742 CCTTTTGGGGAGGGCAGGAAGGG - Intergenic
1064019253 10:11796110-11796132 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1064973509 10:21089752-21089774 TTATCTGGGCAGGGGAAGGAGGG - Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065164392 10:22960091-22960113 ACTGCAGGGGAGGGGAAGGTTGG - Intronic
1065430765 10:25653110-25653132 CTTTCTAGGGAAGGGAAGGGAGG - Intergenic
1065789969 10:29251560-29251582 CCTGCTGGGGAGGGAAAAGCTGG + Intergenic
1066992166 10:42525884-42525906 ACTTTTGGGGGGGGGAATGAGGG + Intergenic
1067298615 10:44990472-44990494 GTTTCTGGGGAGGCGAAGGGTGG + Intronic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1067709662 10:48637817-48637839 CCTTGTTGGGAGGGGAATGTAGG - Intronic
1067832864 10:49620473-49620495 CCTGCCGGGGAGGGCAGGGAAGG - Exonic
1068545123 10:58335646-58335668 CCTCCCCGGGAGGGCAAGGAAGG + Intronic
1069029184 10:63577533-63577555 GCTACTGGGGAGGCCAAGGAGGG - Intronic
1069120001 10:64557498-64557520 CCATTTTTGGAGGGGAAGGAAGG + Intergenic
1069573329 10:69507388-69507410 GCATCTGGGGAAGGGCAGGAGGG + Exonic
1070523767 10:77277164-77277186 CCTTCAAGGGAGGAGAAGAAGGG + Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070804636 10:79263919-79263941 CCACCTGGGAAGGGTAAGGAGGG + Intronic
1071021404 10:81061212-81061234 CCTTCTTGGGGAGGGAAGGAAGG + Intergenic
1071158873 10:82723306-82723328 ACTACTGGAGAGGGGAAGGATGG + Intronic
1071469878 10:85976475-85976497 CCTTCAGGTGAGTAGAAGGAAGG + Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071970128 10:90896678-90896700 CCTTCTGGTGAGGGAGAAGAAGG - Intronic
1072196248 10:93119281-93119303 CCTGCTGGGGTGGAGAAGGGCGG + Intergenic
1072314542 10:94189406-94189428 TCTTGTGGGGAGAGGAGGGAAGG - Intronic
1072551413 10:96480313-96480335 CCATCTGGGCAGGAGAAGGGAGG + Intronic
1072641611 10:97215239-97215261 CACTCTGGGGAGGAGAAGCAGGG - Intronic
1073103749 10:101020675-101020697 TCTCCTGGGGAGGGGATGGTGGG + Exonic
1073593730 10:104780010-104780032 GCTTATGGGGAGGGGAAGGGAGG + Intronic
1074359953 10:112817696-112817718 CCTGGTGGGGCAGGGAAGGAAGG - Exonic
1074493064 10:113955966-113955988 CACTCTGGGGAGGGGTAGGCGGG + Intergenic
1074643971 10:115422860-115422882 CCTACTGGAGAGGTGGAGGAAGG + Intronic
1075683921 10:124350889-124350911 CCTGCCGGGGAGGGTAGGGATGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1075950126 10:126469911-126469933 GCTGCTGCAGAGGGGAAGGAAGG + Intronic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076272462 10:129166204-129166226 GCTTCAGGGCACGGGAAGGAGGG + Intergenic
1076619066 10:131775482-131775504 CCTTCTGGGGATGGGCAGACAGG + Intergenic
1076634850 10:131875512-131875534 TCCTCTGGGGAGGGGCAGGCGGG - Intergenic
1077108878 11:853435-853457 CCTACCTGGGAGGGGAAGGGAGG + Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077269677 11:1669791-1669813 CCTGCTGGAGAGAGGAAGGAGGG + Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077408812 11:2394180-2394202 CCTGCTGGGGACGGTAAGGCAGG + Exonic
1077485580 11:2837066-2837088 TCTCCTGGGGATGGGCAGGATGG + Intronic
1077485944 11:2838496-2838518 CCTGCTGGGCTGGGGAAGGGAGG + Intronic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077888907 11:6405002-6405024 CCTTGGGGGGTGGGGAAGGGAGG + Intronic
1078095364 11:8293123-8293145 TCCTCCGGGCAGGGGAAGGAAGG + Intergenic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078615832 11:12864816-12864838 CCTGCAGGGTAGGGGAAGGGAGG - Exonic
1079074374 11:17374647-17374669 GGTTCTGGGGAGAGGAAGGGAGG - Exonic
1079117276 11:17647823-17647845 CCATGTGGGAAGGAGAAGGAGGG + Intergenic
1079244506 11:18742877-18742899 CATTCTGGGTGGGGCAAGGAGGG - Intronic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080791423 11:35525611-35525633 TCTACTGGGGAGGGAGAGGAGGG + Exonic
1080800804 11:35608672-35608694 CCTGCTAGGGAGGGGTAGTAAGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081546307 11:44074437-44074459 GGTACTGGGGAGGGGAAGGTGGG + Intronic
1081644147 11:44778156-44778178 AGTTCTGAGGTGGGGAAGGAAGG + Intronic
1081853836 11:46291659-46291681 CCTACTGGGTGGGGGAAGGAAGG + Intronic
1082285812 11:50317090-50317112 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1083268674 11:61559501-61559523 GCTTTTGAGCAGGGGAAGGATGG + Intronic
1083722273 11:64609250-64609272 GGTTCTGGGGAGGGGGAGGGGGG - Intronic
1083815976 11:65132701-65132723 GATTCAGGGGAGGGGAAGGGAGG - Intronic
1084014822 11:66371963-66371985 CCTGCGGCGGAGGGGAAGGCGGG + Intronic
1084173204 11:67410368-67410390 CCCTGGAGGGAGGGGAAGGAGGG - Intronic
1084312921 11:68327078-68327100 CCTGCTGGGGCGGGCAGGGACGG - Intronic
1084489161 11:69468962-69468984 CCCGGTGGGGAAGGGAAGGAGGG + Intergenic
1084605860 11:70171228-70171250 GCATCTTGGGAGGGGAAGGGTGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084854886 11:71976948-71976970 GCTTGTGGGGAGGGAAAGGGAGG - Intronic
1084964285 11:72736352-72736374 GCTACTGGGGAGGGGGAGGTGGG - Intronic
1084967570 11:72752459-72752481 ACTCCCGGGGAGGGGAAGGTGGG + Intronic
1085455189 11:76661505-76661527 CCACCTGGGGAGGGGTAGGGTGG + Exonic
1085589778 11:77749137-77749159 CCCAGTGGGTAGGGGAAGGAAGG + Intronic
1086162033 11:83732803-83732825 CCAACTGGGGAGGGGAATGGGGG + Intronic
1087789983 11:102395411-102395433 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1088578724 11:111297334-111297356 CCTTCTGTGGAGGGGGCGGGTGG + Intergenic
1089044512 11:115488372-115488394 CATTATTGGGAGGGGGAGGAGGG - Intronic
1089253928 11:117183857-117183879 CCTTCTGCGAAGGGGTAGAAAGG - Exonic
1089642975 11:119859746-119859768 CCTCCTGGGGACAGGAAGCATGG - Intergenic
1089833284 11:121347923-121347945 CCTCCAGGGGATGTGAAGGAAGG + Intergenic
1089934556 11:122350376-122350398 GCTTCTTGGGGGCGGAAGGATGG + Intergenic
1090239365 11:125171211-125171233 CTTGCTGGGGAGGGGCAGCATGG + Intronic
1090293937 11:125569693-125569715 CCTTATGGGAAGGGGCCGGAGGG + Intronic
1090424321 11:126596483-126596505 CCTTCTGAAGGGGGGAAGGTAGG + Intronic
1090602015 11:128382473-128382495 CCTACTTGGGAGGGTAAGGCAGG - Intergenic
1090844109 11:130516667-130516689 CCTTCTGAGGAGGCAAAGCATGG + Intergenic
1091305865 11:134535745-134535767 CCTCATGGGGATGGGATGGAGGG + Intergenic
1091765855 12:3119578-3119600 CCCTCCGGGCAGGGGCAGGACGG - Intronic
1092171802 12:6378119-6378141 CCCTTTGGGGAGGGAAAGGAAGG - Intronic
1093203177 12:16214511-16214533 ACTTCTGGGGAGCAGAAGGAGGG + Intronic
1093436437 12:19140151-19140173 CCGTCTGGGGAGTGGGATGATGG + Intronic
1093575677 12:20726858-20726880 ACTACTGGAGAGGGAAAGGAAGG - Intronic
1094709946 12:32952001-32952023 CTTTCTGCTGAGGGGAGGGAAGG - Intergenic
1094762179 12:33546688-33546710 ACTACTGGGGTGGGGAGGGAAGG + Intergenic
1096080009 12:48826955-48826977 ACTCCTGGGGAGGGGGAGGAAGG - Exonic
1096114761 12:49049403-49049425 CACTCTTGGGAGGGGAAGAATGG - Intronic
1096148415 12:49294535-49294557 TCTTCAGGGGAGGGGGAGGGGGG + Exonic
1096431236 12:51545038-51545060 CCTGCTGTAGAGGGAAAGGATGG - Intergenic
1096441569 12:51648048-51648070 GCCTCTGGGGAGGAGAAGGGTGG + Intronic
1096717224 12:53499031-53499053 CCCTCTAGGGAAGGAAAGGAAGG - Intronic
1096764138 12:53869167-53869189 ACTACTGGAGAGGGGAAGGAGGG - Intergenic
1096912878 12:55001672-55001694 CCTACTCTGGAAGGGAAGGAGGG - Intergenic
1098406653 12:70133366-70133388 GCTACTTGGGAGGGTAAGGAGGG + Intergenic
1098439703 12:70504653-70504675 GCTCCTGGGCAGGGGAAGGACGG - Intergenic
1100364148 12:93903961-93903983 CCGTCTGTGAAGGGGAAGAAGGG + Intergenic
1100632016 12:96399538-96399560 GCTGCCCGGGAGGGGAAGGAAGG - Intronic
1101262336 12:103045797-103045819 TCTTCTGGGCAGGTCAAGGAGGG - Intergenic
1101529279 12:105559547-105559569 CCTTCCGGGAAAGGCAAGGAAGG + Intergenic
1101593255 12:106140581-106140603 GCTCCTGGGGAAGGGAAGAAGGG - Intergenic
1102100016 12:110270907-110270929 CCTTGGGGGGTGAGGAAGGAGGG + Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102222750 12:111205412-111205434 CCTTGTGGCGGGGGGATGGAGGG - Intronic
1102505964 12:113384829-113384851 CCTGCCGGGCAGGGGAAGGGAGG - Exonic
1102577109 12:113862848-113862870 CCTGGTGGGGGAGGGAAGGAGGG - Intronic
1103083468 12:118043454-118043476 ACTTTTGGGGAGTGGAGGGAAGG + Intronic
1103512357 12:121484121-121484143 CCTGCAGGAGAGGGGAAGGTGGG - Intronic
1103531614 12:121606249-121606271 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1103896135 12:124274478-124274500 CCTTCTGGGGGAGGGGAGGGCGG + Intronic
1104278886 12:127355520-127355542 CCTTCTGGTGAGGGAAGGCATGG + Intergenic
1104330768 12:127842659-127842681 CCTTTTTGTGAGAGGAAGGATGG - Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104735487 12:131133587-131133609 CCTTCCGGGGAGGTGCAGGCAGG + Intronic
1104768514 12:131345892-131345914 CCTCCTGGGGCAGGGCAGGAGGG - Intergenic
1104933281 12:132351667-132351689 CCCTCTGGGGACAGGAGGGATGG + Intergenic
1104968980 12:132522706-132522728 CTTCCTGGGGTGGGGAAGGAAGG - Intronic
1105373472 13:19821258-19821280 GCAGCTGGGGAGGTGAAGGATGG + Intergenic
1105757866 13:23486216-23486238 ACTCCTGGGGAGGGGAAGAAAGG - Intergenic
1105777882 13:23679981-23680003 CCTTCTGGGGACAGTGAGGAGGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106301941 13:28474656-28474678 GCTTGCGGGGAGGGGATGGAGGG + Intronic
1106462684 13:29986799-29986821 GCTACTTGGGAGGGTAAGGAAGG - Intergenic
1106703817 13:32259175-32259197 CATTTGGGGGAGAGGAAGGATGG + Intronic
1107155154 13:37157569-37157591 ACTACTAGAGAGGGGAAGGAGGG - Intergenic
1107187206 13:37537706-37537728 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1107386277 13:39913361-39913383 CCTTCTGAGGAATGGAAGGGAGG + Intergenic
1107414508 13:40188387-40188409 CCTTCTTGGTAGGAGAAGGCAGG - Intergenic
1107427929 13:40312930-40312952 CCCTCTGTGGAAGGAAAGGAAGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1107890802 13:44912565-44912587 CCTTCTCGGGTGGGGAAGCTGGG + Intergenic
1108335509 13:49437410-49437432 GCTTCTGGGGAAAGGAAAGAGGG - Intronic
1108641372 13:52385518-52385540 CCCTCTGGGTAGGGGCAGTAAGG + Intronic
1108699339 13:52930502-52930524 CCTTCTGGGGTGGAGGTGGAGGG + Intergenic
1109162831 13:58997356-58997378 CCTGCTGGGGGGTGGGAGGAGGG - Intergenic
1110760485 13:79225259-79225281 CTTCCTAGGGAGGGGGAGGAGGG + Intergenic
1111572201 13:90103635-90103657 ACTGCTGGGGGGGTGAAGGAGGG + Intergenic
1111677894 13:91409859-91409881 ACTTCTAGAGAGGGGAGGGAGGG - Intronic
1112811797 13:103226597-103226619 CCTGCTGGGCTGGGGAGGGATGG + Intergenic
1112913857 13:104522605-104522627 TGTTCTGGGGCGGGGAAAGAAGG - Intergenic
1113364298 13:109661870-109661892 GCCTCTGGGCAGGGCAAGGAGGG + Intergenic
1113422960 13:110184214-110184236 GCTTCTGGGGAGGGGGAACAGGG - Intronic
1113942045 13:114023378-114023400 CCGGCTGGGGAGGGTCAGGAGGG + Intronic
1114392057 14:22320278-22320300 AATTCTGGGGAGGGGAGAGAAGG + Intergenic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1115297067 14:31840460-31840482 CCTACTGGGGAGGCGGAGGTAGG + Intronic
1115751907 14:36502562-36502584 CATTCTGGGAAGGGCAAGGAGGG - Intronic
1116246502 14:42421161-42421183 ACTTCAGGTGAGGGGAAGGTAGG - Intergenic
1118473475 14:66095434-66095456 CCTTGTGGGGGAGGGAAAGACGG + Intergenic
1119201445 14:72755830-72755852 CCTGTTGAGGAGGGCAAGGAAGG - Intronic
1119235829 14:73018317-73018339 CCTACTTGGGAGGCGGAGGAAGG + Intronic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119522907 14:75299143-75299165 CCTTCAGTAAAGGGGAAGGAGGG + Intergenic
1120261321 14:82189372-82189394 CCTTATGGGAAAGGAAAGGATGG - Intergenic
1121075094 14:91060942-91060964 CGTTCTGGGGAGGTCAGGGAAGG - Intronic
1121717310 14:96085418-96085440 CCTCCTGGGCTGGGGCAGGAAGG + Intronic
1122003315 14:98682501-98682523 GCTACTGGGGAGGAGAAGAAAGG + Intergenic
1122003495 14:98683729-98683751 GCTACTGGGGAGGAGAAGAAAGG + Intergenic
1122630782 14:103106922-103106944 CCTGCTGGGCATGGGAAGTAGGG - Intronic
1122808849 14:104277743-104277765 CCTTTTGGAGAGGGAAAGGGCGG - Intergenic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1122898373 14:104771680-104771702 CATTCAGGGGAGGGGCAGGCTGG + Intronic
1123992501 15:25694058-25694080 CCTCCTGGTGAGGGCCAGGAAGG - Intronic
1124113408 15:26814931-26814953 GCTTCAGGGGGAGGGAAGGAGGG + Intronic
1124216648 15:27812979-27813001 CCTCCTGGGGAGGGGGCAGAAGG - Intronic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1125571354 15:40721069-40721091 GCTACTTGGGAGGGTAAGGAAGG + Intronic
1125597332 15:40895200-40895222 CCTTCTGGAGGTGGGAGGGAAGG + Intronic
1127113389 15:55698603-55698625 TCTTCTGGGGTAGGGCAGGATGG + Intronic
1127386712 15:58473046-58473068 ACAGCTGGGGAGGGGGAGGACGG + Intronic
1127810469 15:62561006-62561028 CCTTCTGTGTAGAGGAAGAATGG - Intronic
1127986780 15:64078927-64078949 GCTACTTGGGAGGGTAAGGAGGG + Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1128789569 15:70423189-70423211 CCTCCTGGGGATGGGAAAGCAGG - Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129699043 15:77757119-77757141 ACTGGTGGGGAGGGGAAGGCAGG - Intronic
1129881242 15:79007661-79007683 GCTACTGGGGAGGGTAAGGCAGG - Intronic
1129890561 15:79069023-79069045 CCTGTAGGTGAGGGGAAGGATGG - Intronic
1130036420 15:80365524-80365546 CCTGCTGGGCAGGTGCAGGAGGG + Intronic
1130742162 15:86612433-86612455 GGGTCGGGGGAGGGGAAGGATGG + Intronic
1131255764 15:90860940-90860962 CCTGCTGGGCTGGGCAAGGAAGG - Intergenic
1132107831 15:99076828-99076850 ACTCTTGGGGAGGTGAAGGACGG - Intergenic
1132108609 15:99085504-99085526 CCCTCTGGGGAGGAGAGGAAGGG - Intergenic
1132153072 15:99475944-99475966 CTATCTGGGGTGGGGAGGGAGGG - Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132498586 16:275079-275101 GCCTCTGGGGAGGGGTGGGACGG + Exonic
1132701740 16:1225010-1225032 CGTGCTGGGGAGAGGCAGGAGGG - Intronic
1132708860 16:1257835-1257857 CCATCTGGGGAAGGGAGGGGAGG - Intronic
1132755274 16:1481485-1481507 CATGCTGGGGAGGGGAAGCCAGG + Intergenic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1132884539 16:2176823-2176845 CCATCTAGGGTGGGGATGGAGGG - Exonic
1134060526 16:11197068-11197090 CGTTCTGGGGAGGTGAAGAAAGG + Intergenic
1134061426 16:11201902-11201924 GGCCCTGGGGAGGGGAAGGAGGG + Intergenic
1134086155 16:11358776-11358798 GCTTCTGAGGAGGAGAAGAAAGG + Intergenic
1134092513 16:11399179-11399201 GCTTCTCGGGAGGGGGCGGAGGG - Intronic
1134115303 16:11543614-11543636 CCTTTTGGGGAGGCTAAGGCAGG - Intergenic
1134305628 16:13029495-13029517 CCTACTCGGGAGGCTAAGGAGGG + Intronic
1135115412 16:19719003-19719025 CCGCCTGGGGAGGTTAAGGAAGG - Intronic
1135993204 16:27229963-27229985 CCATCAGGGGAGGGGCAGGAGGG + Intronic
1136026003 16:27469536-27469558 CCTTCTAGCTTGGGGAAGGACGG - Exonic
1136234701 16:28906218-28906240 CCTGCTGGGCTGGGGCAGGAGGG + Intronic
1136413719 16:30091403-30091425 CCTCCCGGGGTGGGGAGGGAGGG - Intronic
1136498997 16:30660244-30660266 CCTTCTGTGGAGGAGGAGGTGGG - Exonic
1136636514 16:31527791-31527813 CATTCTAGGGAGGAGAAGAAGGG - Intergenic
1137616244 16:49848956-49848978 CTTTCTGGGGAAGGCAGGGAGGG + Intronic
1137687059 16:50393556-50393578 ACCACTGGGGAGGGGCAGGAGGG - Intergenic
1137943055 16:52707842-52707864 ACTTGGGGGGAGGGGAAGGAAGG - Intergenic
1138153604 16:54682600-54682622 CCATTTGGGGATGGCAAGGAGGG + Intergenic
1138291278 16:55849282-55849304 ATTTCTGGGAAGGGGAGGGAGGG + Intronic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138506267 16:57479831-57479853 CGTCCTGGGGTGGGGAGGGAAGG - Intronic
1138523875 16:57590549-57590571 GCCTCTGGGGAGGGGAGGTAGGG + Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139699344 16:68698086-68698108 CCTTTAGGGGAGGGGAGAGAGGG + Intronic
1140107139 16:71971133-71971155 CCTTTGGTGGAAGGGAAGGAAGG + Intronic
1140332356 16:74070271-74070293 CCTGCAAGGGATGGGAAGGAAGG + Intergenic
1140894035 16:79309376-79309398 CCTTCTGGAGAGATGAAGGTGGG - Intergenic
1142227849 16:88886141-88886163 GCCTGTGGGGTGGGGAAGGAGGG + Exonic
1142256764 16:89017597-89017619 CCTTCGGGGGAGGGTAAGTGAGG + Intergenic
1142323768 16:89401096-89401118 CCCTCTGGGGAGGGGGAGGGCGG - Intronic
1142591583 17:1008528-1008550 CCTTGTGGGGAGGAGTGGGAAGG - Intronic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142869794 17:2812622-2812644 CGTCCTGGGGGAGGGAAGGAAGG - Intronic
1142886038 17:2912514-2912536 CTTTCTGGGCTGGGGCAGGAAGG + Intronic
1143148483 17:4791513-4791535 CATTATAGGGAGGGAAAGGATGG - Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143374298 17:6458256-6458278 TATCCTGGGGAGGGGAGGGAAGG - Intronic
1143497893 17:7322863-7322885 ACCTCTGGGGAGGAGAGGGAAGG + Exonic
1144301596 17:13926558-13926580 GGTTCTGGGGAGGGGAAAGGAGG - Intergenic
1144577236 17:16436808-16436830 CCTCCTTGGGAGGGGAAGCCAGG - Exonic
1145167030 17:20621689-20621711 CCTCCAGGGGTGGGGAAGGATGG + Intergenic
1145921655 17:28614323-28614345 GCTTCAGGGCAGAGGAAGGAAGG + Intergenic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147260708 17:39208528-39208550 CCTGCTGAGGAGTGCAAGGAAGG - Intergenic
1147441080 17:40447562-40447584 CCTTGTGGGGAGGGGGAGGGAGG + Intronic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147686553 17:42289551-42289573 CCCTCTGAGGAGGGGCAGGGCGG - Intronic
1147725735 17:42565208-42565230 GCTTCTGGGGAGGGGAACAGAGG - Exonic
1147758728 17:42784188-42784210 TCTTCTGAGGTGGGGGAGGAAGG - Intronic
1148090835 17:45021764-45021786 CCTTCTGGGCGGGGGACGAAGGG - Intergenic
1148109852 17:45138173-45138195 CCCTTTGGGGAGAGGAGGGAGGG - Intronic
1148860958 17:50604136-50604158 CACCCTGGGGAGGGGAGGGAGGG - Exonic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149440971 17:56673571-56673593 CAATCTGGGGAGAAGAAGGAGGG + Intergenic
1149852546 17:60047841-60047863 ACCTCTGGGGAGGGGAACTAAGG + Intronic
1150453705 17:65290325-65290347 CACTCTGAGGAAGGGAAGGAAGG + Intergenic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1151086209 17:71384045-71384067 CCCTGTGGGGATGGGGAGGAGGG + Intergenic
1151474751 17:74339177-74339199 CCTTGTGGGGTGGGGCAGGTAGG - Intronic
1151543185 17:74775947-74775969 AGTTCTGGGGAGTGGACGGAAGG - Intronic
1151698449 17:75730222-75730244 CCCTCTGGGGAAGGCAAGGCGGG - Exonic
1151745695 17:76010540-76010562 CCTTCTGCAGAGAGGAAGAAGGG + Exonic
1151904651 17:77039755-77039777 CCTTCTAGGGAGGCAAAGGTTGG - Intergenic
1152354861 17:79801801-79801823 CTTCCTGTGGAGGGGAAGAAAGG - Intergenic
1152589759 17:81205650-81205672 GCTTTTGGGGAGGTCAAGGAAGG + Intronic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1153893672 18:9540479-9540501 CCAGCTGGGGAGGGGAAGGAAGG + Intergenic
1153907648 18:9677285-9677307 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1153930096 18:9870632-9870654 GCTTCTGGGCTGGAGAAGGAGGG - Intergenic
1155025813 18:21939876-21939898 TCTGCTGGGGAGGAGAAGGCAGG - Intergenic
1155324055 18:24648364-24648386 ATTTCTGGGGTGGGGATGGAGGG + Intergenic
1155341872 18:24821274-24821296 CTTCCTTGGGAGGGCAAGGAGGG + Intergenic
1155548337 18:26938849-26938871 CTTACCTGGGAGGGGAAGGAAGG + Intronic
1156439657 18:37171562-37171584 GTTTATGGGGAGGGAAAGGAAGG - Intronic
1157569616 18:48703833-48703855 CTTTCTGGAGAGGAGAAGGGAGG + Intronic
1157757320 18:50230338-50230360 ACCTCTTGGGAGGGGAAGGTGGG + Intronic
1157937659 18:51891094-51891116 CCTCATGGGGAGGTGATGGAAGG + Intergenic
1158440529 18:57470857-57470879 GCTGGTGGGGAGGGGAAGCAAGG - Intronic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1159002043 18:62982899-62982921 TCTTCTGGGAAAGTGAAGGAAGG - Intergenic
1159008951 18:63040312-63040334 CCTTCTGGGGACTGTGAGGAAGG + Intergenic
1159300050 18:66552049-66552071 ACTACTAGAGAGGGGAAGGAGGG + Intronic
1159899183 18:74027134-74027156 CCTTCTGGCGAGTGGAGGCAAGG + Intergenic
1160021439 18:75184951-75184973 TCTGCTGGGGAAGGGAAGGGAGG - Intergenic
1160031818 18:75268657-75268679 TTTTTTGGGGAGGGGGAGGAGGG - Intronic
1160044116 18:75371034-75371056 GCTTCTGGGTCGGGGAAGCAAGG - Intergenic
1160493199 18:79354950-79354972 CTTTTTGGGGAGGGGGAGGTGGG - Intronic
1160525604 18:79533729-79533751 CCTTCTGGGGATGCCAAGGTGGG - Intergenic
1161039343 19:2101717-2101739 CGTCCGGGGGAGGGGAAGGAAGG - Exonic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161430405 19:4229205-4229227 GCTTCAGGGCAGCGGAAGGAAGG + Intergenic
1161452695 19:4355197-4355219 CATTCTGGGGAGGGTTGGGAAGG + Intronic
1161514550 19:4689398-4689420 CCTCCTGGGTAGGGCAGGGAAGG - Intronic
1161950358 19:7464403-7464425 CCTGCTGGAGAGGGGCAGGCTGG - Intronic
1162372131 19:10285979-10286001 CCTTCTGGGGAAAGGCAGGTTGG - Exonic
1162791077 19:13063301-13063323 GCTTCTGGGGAAGGGAGGGAAGG - Intronic
1163112420 19:15169819-15169841 CTGGCTGGGGAGGGGCAGGATGG + Intronic
1163122386 19:15225823-15225845 CCCTCTGGGGTGGGGATGGGTGG - Intergenic
1163737548 19:18990618-18990640 CCTTCTGGGGAGGCTGGGGAGGG - Intergenic
1163779000 19:19235855-19235877 CCTACTGGGGAGGCTAAGGAGGG - Intronic
1164577129 19:29412054-29412076 CCTTCTGGAAAGGGGAAGCTGGG - Intergenic
1164854599 19:31511235-31511257 CCATATGGGGAGTGGTAGGAGGG + Intergenic
1164934782 19:32202075-32202097 GCCCATGGGGAGGGGAAGGAAGG + Intergenic
1165008099 19:32823059-32823081 CCTCCTGGGAAGCGGAATGAGGG - Intronic
1165243868 19:34486784-34486806 CCTACAGGGAAGGGGCAGGACGG - Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165774991 19:38399105-38399127 CGTTTTGGGGAGGGGTGGGACGG + Intergenic
1165873765 19:38991431-38991453 CCAGCTGGGAAGAGGAAGGAGGG - Intronic
1165903506 19:39179571-39179593 CATTCTGGGGAGTGGCAGGCTGG - Intronic
1166826970 19:45615889-45615911 CCTGCGGGGGAGGGAAGGGATGG + Exonic
1166885157 19:45956136-45956158 TGTTCTGGGGTGGGGAAGGGGGG - Intronic
1166942333 19:46374407-46374429 GCTCCTGGGGAGGCTAAGGATGG + Intronic
1166979094 19:46622207-46622229 CCCATTGGGGAGGGGCAGGACGG + Intronic
1167200391 19:48061272-48061294 CCATGAGGGGAGGGGAAGGGAGG + Intronic
1167293814 19:48638070-48638092 CCTTGTGGGGAGGCTTAGGACGG + Exonic
1167302193 19:48684619-48684641 CCTTCTGGTGAGGGACAGGGCGG - Intergenic
1167634625 19:50647347-50647369 ACTTGTGGGGAGAGGAATGAGGG + Intronic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
1168291364 19:55359253-55359275 CCTTCTGGGATGGGGCAGGGAGG + Exonic
924985074 2:263657-263679 GCTTCTGTGGAACGGAAGGATGG + Intronic
925307606 2:2861281-2861303 CCACCAGGGGAGGAGAAGGATGG + Intergenic
925607120 2:5670934-5670956 CCTGCTGGGGAAGACAAGGAAGG - Intergenic
926890730 2:17637119-17637141 CCCTGTGGGAAGGGGAAGGGAGG - Intronic
927186392 2:20485523-20485545 TCTTCTCAGGAGGGGAGGGAAGG - Intergenic
927362639 2:22253899-22253921 CCTTCTGGGGAAGCAAAAGATGG + Intergenic
927567398 2:24124804-24124826 GCTACTAGGGAGTGGAAGGATGG - Intronic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
928245066 2:29619826-29619848 CCTTCTGACAATGGGAAGGATGG + Intronic
928931884 2:36633327-36633349 CCTACTGGAGAGGGGAGGGAGGG - Intronic
929508301 2:42546089-42546111 CCTGGTAGGGAAGGGAAGGAGGG + Intronic
930002480 2:46870527-46870549 ACTGCTGAGGAGGGGAAGGTGGG - Intergenic
930081561 2:47453389-47453411 ACTCCTGGGAAGGGGGAGGAAGG + Intronic
930103113 2:47618120-47618142 CCTTCTGGGGAAGGGAAGGGAGG + Intergenic
930774564 2:55159329-55159351 CCTACTGGGGAAGGGATTGAGGG + Intergenic
930997471 2:57737879-57737901 CCTTGTGGGGAGGGGACAGGTGG - Intergenic
931506413 2:62932063-62932085 GCTACTTGGGAGGGTAAGGAAGG + Intronic
932011176 2:67978712-67978734 CATGCTGTGTAGGGGAAGGAAGG - Intergenic
932404180 2:71502933-71502955 GCCTCTGGGGAGGGGCAGGAAGG + Intronic
932438640 2:71717873-71717895 CCATCAGGGGAGGGTAAGGAGGG + Intergenic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934601804 2:95663634-95663656 CCTTCAGGGGAGGGGGACGGGGG + Intergenic
934768986 2:96895962-96895984 CCTTTTGGGAGGGGGGAGGAAGG + Intronic
934996046 2:98961555-98961577 CCTACTGGAGAGTGGGAGGAGGG - Intergenic
935396868 2:102619194-102619216 CCTGCGGGGGCGGGGGAGGAGGG + Intergenic
936037332 2:109123386-109123408 GCTTCAGGGGAAGGGAGGGAGGG - Intergenic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936535156 2:113305789-113305811 CCTTCAGGGGAGGGGGACGGGGG + Intergenic
936577404 2:113668071-113668093 CCCTCTGGGCAGGGGAAGAGTGG - Intergenic
936611981 2:114010486-114010508 CTTGCTGGGCATGGGAAGGAAGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
938118905 2:128620223-128620245 CCTCCAGGACAGGGGAAGGAAGG - Intergenic
939642503 2:144657354-144657376 CCTTCTGTGGTGGGGGAGGAGGG - Intergenic
939677320 2:145088473-145088495 GGTTCAGGAGAGGGGAAGGAGGG + Intergenic
940089662 2:149901269-149901291 CCAGTTGGGGAGGAGAAGGAGGG + Intergenic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
941003252 2:160222615-160222637 CCTTCTGGAGAGGGGAATTGGGG + Intronic
945160924 2:206889688-206889710 CCTTCTTGAGAGTGGAGGGAAGG - Intergenic
946012193 2:216574179-216574201 CCTCCAGGGGTGGGGAAAGAGGG + Intronic
946327715 2:218993342-218993364 TCTGCTGGGGTGGGGAAGGGAGG - Exonic
946393429 2:219430296-219430318 GCTTGTGGTGAGAGGAAGGAGGG - Intergenic
947114598 2:226755672-226755694 AGTTGTGGGGAGGGGAAGGATGG - Intronic
947138857 2:227002056-227002078 CCTACTGGGGAGGGTGAGGCAGG + Intergenic
947305364 2:228740546-228740568 CCCTTTGGGGAAAGGAAGGAAGG - Intergenic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
947561397 2:231156503-231156525 ACTTGTGGGGAGGGCAAGGAGGG - Intronic
948285009 2:236777378-236777400 CCTGCTGAGGAGGAGAAGAAAGG - Intergenic
948362458 2:237432740-237432762 GGTTCTGGGGAAGGGAAGGGAGG + Intergenic
948571571 2:238920957-238920979 TCATCTGCGGAGGAGAAGGAAGG + Intergenic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
949064583 2:241982021-241982043 TCATCTGGGGAGAGGACGGAAGG + Intergenic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1169191792 20:3662674-3662696 CCCTTTGGGGAGGGGAGGAAGGG - Intronic
1169356767 20:4913197-4913219 CCTTCAGGGGAAGGGAAGTTTGG + Intronic
1169509904 20:6252202-6252224 ACTTCTGGAGAGGGGAAGGAGGG + Intergenic
1170006828 20:11678459-11678481 CCTTGAGTGGAGGTGAAGGAGGG - Intergenic
1170270303 20:14520056-14520078 CCTTCTGGAAAGTGGAGGGAGGG + Intronic
1170572689 20:17641356-17641378 CCTTGTGGGGAGGGGACTGGAGG - Intronic
1170707919 20:18762095-18762117 CCAGCTGGGCAGGGGAATGAGGG + Intronic
1170859231 20:20087285-20087307 ACTTCTAGGGAGGGGAGAGAAGG - Intronic
1171133775 20:22678445-22678467 CCCTCTGGACAGGGAAAGGAAGG + Intergenic
1171166292 20:22974805-22974827 AATTCTGGGGATGGGCAGGAGGG + Intergenic
1171192805 20:23171341-23171363 ACTTGGGGGGAAGGGAAGGAGGG - Intergenic
1171372293 20:24669667-24669689 CCCTGTGGGGAGAGGAAGAAGGG + Intergenic
1171433952 20:25104769-25104791 CTGGCTGTGGAGGGGAAGGAGGG - Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172026728 20:31953686-31953708 CCACCTGGTGTGGGGAAGGAGGG + Intergenic
1172056073 20:32155204-32155226 CTTGCTGGGGAGGGGCTGGAAGG - Intronic
1172096626 20:32463665-32463687 CCTTCTGGAGACGGGACAGAGGG - Intronic
1172208642 20:33182102-33182124 CATTCTGGGGTGTGGATGGAGGG - Intergenic
1172598416 20:36166751-36166773 CCTACTGGGGAGGCCAAGGCAGG + Intronic
1172711660 20:36929341-36929363 CCCTCAGGGCAGGGGAAGGGAGG - Intronic
1172775768 20:37405887-37405909 GCTTCGGTGGTGGGGAAGGAGGG - Exonic
1173306203 20:41852469-41852491 TCCTCTGGAGAGGGAAAGGAGGG - Intergenic
1173370244 20:42428613-42428635 GCTTCACAGGAGGGGAAGGATGG + Intronic
1173686912 20:44930415-44930437 GCTGCTGGGGTGGGGAAGGAAGG - Intronic
1173836543 20:46129715-46129737 ACGTCTGGGGTGGGGAAGAAGGG + Exonic
1173859612 20:46274271-46274293 CTTTCTGGGGCTGGGAAGGCTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174126761 20:48312073-48312095 GATTCTGGGAAGTGGAAGGAGGG - Intergenic
1174298785 20:49567840-49567862 CCTTCTTGGCAGGGGGAGCACGG + Intronic
1174371580 20:50092399-50092421 TCTGCTGGGAAGGGGAAGGGAGG + Intronic
1174426318 20:50433991-50434013 CCTGCAGGGGAGGGGAGGGGAGG - Intergenic
1174458100 20:50663790-50663812 CCTTCTGGGGATGGGGATCAGGG - Intronic
1174846670 20:53949536-53949558 CCTTCCTGGGAGGGGAATGCTGG - Intronic
1175068570 20:56312060-56312082 CCTCCTGGGTAAGGGAAGAATGG + Intergenic
1176233707 20:64044617-64044639 CCTGCTGGGGCAGGCAAGGAGGG - Intronic
1176326245 21:5503757-5503779 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176401512 21:6317194-6317216 GCTTCTGGGGAGGCTAAGGCAGG + Intergenic
1176435645 21:6671910-6671932 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176459907 21:6998980-6999002 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176483468 21:7380758-7380780 GCTTCTGGGGAGGCTAAGGCAGG - Intergenic
1176549271 21:8214454-8214476 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176557164 21:8258677-8258699 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176568203 21:8397492-8397514 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176576106 21:8441712-8441734 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176925246 21:14741305-14741327 CCTTGTGGGGCTGGGAAGGGAGG - Intergenic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1178362224 21:31958182-31958204 CCTCCTGAGGAGGGGAACCATGG - Intronic
1178638055 21:34322533-34322555 CCTTCTGAGGCTTGGAAGGAGGG - Intergenic
1178951188 21:36987149-36987171 CATTGTGGGAAGGGGAGGGAAGG - Intronic
1179165224 21:38930306-38930328 CCTTCTTGGTAGAGAAAGGAGGG + Intergenic
1179489094 21:41728581-41728603 CCATCTGCCGAGGAGAAGGAGGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180193193 21:46178773-46178795 GCTACTGGGGAGGGCAAGGCAGG + Intronic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180757301 22:18170944-18170966 GCATCTGGGGAGAGGCAGGATGG - Intronic
1180911364 22:19453126-19453148 CCTTCTGGGATGGGGGAGGGAGG + Intronic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181074478 22:20366521-20366543 GCATCTGGGGAGAGGCAGGATGG + Intronic
1181771023 22:25125674-25125696 ACAACTGGGGATGGGAAGGATGG - Intronic
1182586407 22:31346376-31346398 CCCTGGGGGGAGGAGAAGGAGGG + Intergenic
1182777227 22:32839989-32840011 CCTCCCGGGGAAGGGGAGGAGGG - Intronic
1183095248 22:35548080-35548102 CCTGCTGGGAAGGGTGAGGAGGG + Intronic
1183341329 22:37283557-37283579 CCATCTGGGGGTGGGGAGGAAGG - Intronic
1183378033 22:37476456-37476478 CCTTCTGGGTGAGGGAAGAAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183537892 22:38413681-38413703 GCCTTTGGGGAGGGGAGGGAAGG - Intergenic
1183748512 22:39705881-39705903 ACGTCTGGGGAGCGGCAGGATGG - Intergenic
1184111768 22:42399664-42399686 CCTGCTGGGAAGGTGAAGGCTGG + Intronic
1184598997 22:45531716-45531738 CTGGCTGGGGAGGGGAAGGGTGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184777825 22:46632143-46632165 CCTGCTTGGGAGGGGAAGGTTGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1185186253 22:49402267-49402289 CCCTGTGGGGAGGGGAGTGAGGG - Intergenic
1185422829 22:50744593-50744615 CCCTCTGGGCAGGGGAAGAGTGG + Intronic
1203254156 22_KI270733v1_random:130770-130792 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203262212 22_KI270733v1_random:175849-175871 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
949576812 3:5346120-5346142 CCTTTTGGGGTGGAGAGGGAGGG + Intergenic
950411297 3:12839584-12839606 CCTTTTGGGGAGGGAAAAAAAGG + Intronic
950522508 3:13505345-13505367 CCTTCTGTGGGGGTGAAGGTGGG + Exonic
950630473 3:14278700-14278722 ACTTCTGGGGTGGGGAAAGGAGG - Intergenic
950657817 3:14447913-14447935 TCTTCGGGGGAGTGGGAGGAGGG + Intronic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950729136 3:14941539-14941561 CTTTCTGGTGGGGGGATGGAGGG + Intergenic
951195052 3:19814364-19814386 GCTACTGGGGAGGCTAAGGAGGG + Intergenic
951437689 3:22684060-22684082 CCCTCTGGGGAAGGAAAAGAAGG + Intergenic
951574968 3:24104184-24104206 ACATCAAGGGAGGGGAAGGATGG - Intergenic
951938051 3:28044516-28044538 ACTTATAGGAAGGGGAAGGAGGG - Intergenic
952788171 3:37176316-37176338 CCGACTGAGGAGGCGAAGGATGG + Intronic
952977543 3:38709045-38709067 CCTCCTTGGGATGGGGAGGAAGG - Intronic
953217733 3:40936983-40937005 CCTTCTGGGGAGGGTTGGAAAGG + Intergenic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953752252 3:45617786-45617808 CTTGCTGGGGAGCGGGAGGACGG + Intronic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
954177383 3:48855332-48855354 CCTTCTTGGGAGGTGGAGGTGGG + Intergenic
954299380 3:49691279-49691301 TCTTGTTGGGAGGAGAAGGAAGG + Intronic
954783432 3:53076271-53076293 CCCTCTGGGGAAGGGAGGCAGGG + Intronic
954787332 3:53103624-53103646 CCCTCTGGGGTGAGGGAGGAAGG - Intronic
955439222 3:58937497-58937519 CTTTCAAGAGAGGGGAAGGAAGG + Intronic
956474698 3:69607876-69607898 CACTCTGGGGAGGAGAGGGAGGG + Intergenic
958933912 3:100237554-100237576 CCTACTAGGGAGGCTAAGGAAGG + Intergenic
960256757 3:115518775-115518797 CCTTGATGTGAGGGGAAGGAGGG + Intergenic
960641792 3:119831917-119831939 CTTTGTGGGGAAGGAAAGGAAGG + Intronic
960962795 3:123083917-123083939 GCTTATGGGGAGGGGAGGAAAGG + Intronic
960964042 3:123092267-123092289 CCCTCAGGGGTGAGGAAGGATGG - Intronic
960989211 3:123299940-123299962 ACTACTGGGAATGGGAAGGAAGG + Intronic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
961111516 3:124287983-124288005 CCTGCTGGGGAGGCTAAGGCAGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961360908 3:126366490-126366512 GCCCCTGGGGAGAGGAAGGAGGG + Intergenic
961614544 3:128168464-128168486 CTTTCTGGGGAGAGAGAGGAAGG + Intronic
962006757 3:131357243-131357265 GCTACTGGGGAGGGCAAGGCAGG + Intergenic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
962255159 3:133865485-133865507 CCATCTGGGGTGGGGGAAGAGGG + Intronic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
962825286 3:139095468-139095490 GCCAATGGGGAGGGGAAGGAGGG - Intronic
963103061 3:141623811-141623833 CCTGCTGGAGGGAGGAAGGAGGG - Intergenic
964150021 3:153512649-153512671 CCTTCTGGGAAGGGAAAGAGTGG - Intergenic
964164224 3:153682064-153682086 CTTCATGGGGAGGGGAAGGGGGG + Intergenic
964379088 3:156079301-156079323 GCTTCTGGAAAGGGGAGGGAAGG - Intronic
964743744 3:159992234-159992256 GCTTCTGAGGAGGGGCAGGAAGG - Intronic
966834360 3:184037999-184038021 CCTGGTGGGGAGGAGAAGGAGGG - Exonic
966931350 3:184677790-184677812 CGGTCTGTGGAGGGGCAGGAGGG - Intronic
967057111 3:185839087-185839109 CCTTTTGGAGGGTGGAAGGAGGG + Intergenic
967877572 3:194277417-194277439 CCCACTGGGGAGGGCAAGGAGGG + Intergenic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968164392 3:196452751-196452773 GCTCCTGGGGAGGCGGAGGAGGG + Intergenic
968631273 4:1653428-1653450 CGTTGTGGGGCGGGGAATGATGG - Intronic
968654203 4:1771679-1771701 CCGGCTGGGGTGGGGGAGGAGGG - Intergenic
968861260 4:3172561-3172583 CCTCCTGGGGAGTGAAGGGAAGG - Intronic
968914606 4:3491985-3492007 CCTCCTGGGGCAGGGCAGGAGGG - Intronic
968939594 4:3631053-3631075 CCTCCTGGGGTGGGGTGGGAGGG + Intergenic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969366060 4:6694801-6694823 CCCGAAGGGGAGGGGAAGGAAGG - Intronic
969522619 4:7687343-7687365 CTATCTGGGGTGGGGCAGGAGGG + Intronic
969867397 4:10084754-10084776 CCTTGGAGGGAGGGGAATGAAGG - Intronic
971036033 4:22693739-22693761 CCCTTTGTGGAGGGGAAGGGGGG - Intergenic
971200718 4:24507344-24507366 ACTGCTGAGGAAGGGAAGGAGGG + Intergenic
971231097 4:24800546-24800568 GCTTATGGGGTGGGGAAGGAGGG - Exonic
971359495 4:25923675-25923697 CCTTTTGGGCAGGGGCAGCAAGG - Intronic
971775677 4:30961438-30961460 CCTACTGGGGAGGCTAAGGCAGG + Intronic
971786251 4:31106636-31106658 CCTTCTGGGGCCAGGAAGTATGG - Intronic
971873996 4:32280742-32280764 CCTTCTGGGGGTGGGGGGGAAGG + Intergenic
972030454 4:34450746-34450768 ACTTCTGGGGAGGGAAGTGAGGG + Intergenic
972553807 4:40160985-40161007 CCTTCTGGGGGTGGGAAGGAGGG - Intergenic
973272571 4:48276543-48276565 CTGTCTTGGCAGGGGAAGGAGGG - Intergenic
973278647 4:48336231-48336253 CCATCTGGGGTGGGGATTGAGGG - Intergenic
973982191 4:56315908-56315930 CTTTCTGCGGAGGGTAAGGAAGG - Exonic
976004634 4:80414691-80414713 CCTTCAGGGGATGGGCAGGGAGG - Intronic
976313365 4:83634390-83634412 ACTACTGGGCAGGGGAAGAATGG - Intergenic
976641487 4:87343406-87343428 TCTGCTGGGGTGGGAAAGGAGGG + Intronic
977332796 4:95658916-95658938 CCTTCTGGGGAGGGGGCTAAAGG - Intergenic
979733423 4:124052579-124052601 CCTTGAGGGGAGGGGAAGAGGGG + Intergenic
980279898 4:130706116-130706138 CCTTCTATATAGGGGAAGGAAGG - Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982805703 4:159760006-159760028 ACTTCTGGAGTGGGGGAGGAAGG - Intergenic
982953755 4:161735425-161735447 GCCTCTGGGGAGGAGAAAGAGGG - Intronic
983373779 4:166898287-166898309 ACCTCTGGGCAGGGGGAGGAAGG + Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985249102 4:188005361-188005383 CCTTCTGAGGCTGGGAGGGAAGG + Intergenic
986333226 5:6733335-6733357 TCTCATGGGGAGGGGAATGATGG + Intronic
986389840 5:7274474-7274496 CTTCCTGGGAAAGGGAAGGAGGG - Intergenic
986710143 5:10482656-10482678 CCTGGTGGGAAGGGGAGGGATGG + Intergenic
987149101 5:15020925-15020947 CCTTGTGGGTATGGGAAGGAGGG - Intergenic
988984896 5:36608084-36608106 CCTCATTGGAAGGGGAAGGACGG + Intronic
989056312 5:37369138-37369160 GCTACTGGGGAGGGCAAGGCGGG + Intronic
989708015 5:44361383-44361405 GCCTCTAGGGAGGAGAAGGATGG - Intronic
991234018 5:64373098-64373120 CCTTATATAGAGGGGAAGGAGGG + Intergenic
991695044 5:69263120-69263142 CTCTCTGGTGAGGGGAAGCAGGG - Intronic
992680987 5:79152904-79152926 GCTACTGGGGAGGTGAAGGCAGG + Intronic
993095680 5:83474879-83474901 GCTTCTTGGGAGTGGTAGGAGGG + Intronic
993501632 5:88673220-88673242 CCTTCTGGGGAGAGGGAGAAGGG + Intergenic
994059354 5:95456749-95456771 CCTCCTTGAGAGAGGAAGGATGG + Intergenic
994591514 5:101779151-101779173 ACTACTGGAGAGGGGAGGGAGGG + Intergenic
995735179 5:115293169-115293191 GCTGGTGGGGAGGGCAAGGAAGG + Intronic
995781744 5:115783935-115783957 TCCTCTGAGGAGGGGAAGGGAGG - Intergenic
995878791 5:116820998-116821020 GCTTCTGGGGAAGGGTAGGTAGG - Intergenic
996490096 5:124084642-124084664 ACTTCAGGGGATGAGAAGGAAGG - Intergenic
996757981 5:126954891-126954913 GCCTCTGGGAAGGGAAAGGAAGG - Intronic
997021130 5:130002827-130002849 CCTTTTTGGGAGGGGCTGGAGGG + Intronic
997102850 5:130987800-130987822 TGACCTGGGGAGGGGAAGGAGGG - Intergenic
997265790 5:132494672-132494694 TCTTCGGGGGAGTGCAAGGATGG - Intergenic
997634371 5:135394145-135394167 CCTGCTGGGAAGGGATAGGAGGG - Intronic
997811450 5:136974396-136974418 CTGGCTGGGGAGGGGAGGGAAGG + Intergenic
998106333 5:139471488-139471510 CCATCTGGGAAGGGGAAGCTAGG + Intergenic
998231170 5:140362226-140362248 TTTACTGAGGAGGGGAAGGAGGG + Intronic
998397191 5:141826327-141826349 CCATCCGGGGAGGGTCAGGAAGG - Intergenic
999147163 5:149404070-149404092 GCTTCTTGGGAGGTGAAGGGAGG - Intronic
999270647 5:150294703-150294725 GCTTGTGGGGAGGGAAGGGAGGG - Intergenic
999303036 5:150502789-150502811 CCTTCTGGGGTAGGCAAGGTTGG + Intronic
999305720 5:150518242-150518264 TCTTCTGGCAGGGGGAAGGAGGG - Intronic
999684261 5:154088425-154088447 CCTTCTGGTGTGGAGAAGGAGGG - Intronic
999825956 5:155274105-155274127 CCCTCTGGGGAGGGGCAGGCGGG - Intergenic
1000009289 5:157216620-157216642 CACTGTGGGGAGGGAAAGGAAGG + Intronic
1000147179 5:158464936-158464958 GCTTCTGGTCATGGGAAGGAAGG - Intergenic
1000329483 5:160195823-160195845 CCCTCTGGGGAAGAGAAAGAGGG - Intronic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1001366091 5:171141493-171141515 GCTTCTGGGGAGGCGGAGGGAGG + Intronic
1002506273 5:179681249-179681271 CATTCTTGGCAGGGGAATGAAGG + Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1003815261 6:9833058-9833080 CCCTCTGGGGCTGCGAAGGAAGG - Intronic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004078274 6:12365460-12365482 CCTTCTGGGTGGGGGCTGGAAGG + Intergenic
1004335582 6:14761653-14761675 CCTACTGGAGGGGGGAAGGTGGG + Intergenic
1004401030 6:15288860-15288882 CCTCCTGGCGAGGTGAAGAAGGG + Intronic
1004419937 6:15460198-15460220 AGGTCTGAGGAGGGGAAGGATGG + Intronic
1004667315 6:17760681-17760703 CCCACTGGGGAGGGGAAAGGAGG + Intronic
1004712964 6:18190036-18190058 GCTACTGGGGAGGGTGAGGAAGG + Intronic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1006303610 6:33206879-33206901 CCTTCGGGAAAGGGAAAGGAGGG - Intergenic
1006405923 6:33844774-33844796 CCTACTGGGAAGGGGCAGGCTGG + Intergenic
1006929690 6:37680267-37680289 CCTGATGGGGAGGGCAAGGTGGG + Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007292307 6:40797060-40797082 CCAGCCGGGGACGGGAAGGAGGG - Intergenic
1007393732 6:41565487-41565509 CGTGCTGGGGTGGGGAAGGGAGG - Intronic
1007397548 6:41586281-41586303 CCTGCTGGGGGTGGGAAGCATGG - Intronic
1007765228 6:44155884-44155906 CCTCCTGGGGAAGGGACAGATGG - Intergenic
1007825763 6:44599509-44599531 CCTACTGGGGAGGCTAAGGCAGG + Intergenic
1008741548 6:54615019-54615041 CTTCCTGGGCAGGGGAAGGTTGG + Intergenic
1008993783 6:57635023-57635045 TATTTTGGGGAGGGGTAGGATGG - Intronic
1009890753 6:69678312-69678334 GCTGATGGGAAGGGGAAGGATGG + Intronic
1010300099 6:74250398-74250420 CCTTCTGGGTTGTGGAAAGAGGG - Intergenic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1012541990 6:100372113-100372135 CCCTCTGGGGAGTAGAAGAAAGG - Intergenic
1012551452 6:100467612-100467634 CCTGCTTGGTGGGGGAAGGAGGG - Intergenic
1013743605 6:113318773-113318795 GCTTCTGGGGCTGGGGAGGAAGG - Intergenic
1014045348 6:116877684-116877706 CCTACTGGGGTGGGGGCGGAGGG - Intronic
1014330320 6:120055903-120055925 TCTTCTAGGGAGGGGAAGATGGG - Intergenic
1014660285 6:124161786-124161808 ACTACTGGAGAGGGGAAGGAGGG + Intronic
1017061782 6:150491311-150491333 CCACCTGGGGAGGGGAAGGGAGG - Intergenic
1017469252 6:154723437-154723459 GCTTCTGGGGAGGGTGAGGCAGG - Intergenic
1017558383 6:155599628-155599650 GTTGCTGGGGAGGGGAAGGAGGG - Intergenic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1018488185 6:164263668-164263690 CCTTTTTGGGAGGAGAAGGAAGG + Intergenic
1018629617 6:165810677-165810699 CATCCTGGGGAGAGGAAGGTAGG - Intronic
1019225042 6:170502140-170502162 CCATCAGGGGAAGGGAATGAGGG + Intergenic
1019225078 6:170502316-170502338 CCATCAGGGGAAGGGAATGAGGG + Intergenic
1019225087 6:170502352-170502374 CCATCTGGGGAAGGAAATGAGGG + Intergenic
1019225094 6:170502388-170502410 CCATCTGGGGAAGGAAAAGAGGG + Intergenic
1019225116 6:170502496-170502518 CCATCAGGGGAAGGAAAGGAGGG + Intergenic
1019225126 6:170502532-170502554 CCATCAGGGGAAGGAAAGGAGGG + Intergenic
1019225153 6:170502676-170502698 CCATCAGGGGAAGGAAAGGAGGG + Intergenic
1019225240 6:170503072-170503094 CCATCAGGGGAAGGAAAGGAAGG + Intergenic
1019225298 6:170503394-170503416 CCATCTGGGAAAGGGAATGAAGG + Intergenic
1019225337 6:170503561-170503583 CCATCAGGGGAAGGGAATGATGG + Intergenic
1019225346 6:170503597-170503619 CCATCAGGGGAAGGGAATGATGG + Intergenic
1019225355 6:170503633-170503655 CCATCAGGGGAAGGGAATGATGG + Intergenic
1019225365 6:170503669-170503691 CCATCAGGGGAAGGGAATGATGG + Intergenic
1019225462 6:170504101-170504123 CCATCAGGGGAAGGGAATGAGGG + Intergenic
1019225472 6:170504137-170504159 CCTTCTGGGGAAGGGAATGTGGG + Intergenic
1019225480 6:170504173-170504195 CCATCAGGGGAAGGGAATGAAGG + Intergenic
1019483595 7:1277343-1277365 CCTACTGGGGGGGGGGAGGGAGG - Intergenic
1019761078 7:2813409-2813431 CCCTCTGGGGAAGGGGAGGTAGG - Intronic
1019987352 7:4667400-4667422 CCATTTGGGGAGGCCAAGGAAGG + Intergenic
1020013147 7:4817130-4817152 CCTTCTGGGGGGCTGAGGGAGGG - Intronic
1020119356 7:5494325-5494347 GCTACTGGGGAGGCGAAGGCAGG + Intronic
1020128492 7:5546362-5546384 CACTTTGGGGAGGTGAAGGAGGG + Intronic
1020262186 7:6536668-6536690 CCTGGTGGGGAGGGGCGGGACGG + Intronic
1022113327 7:27244247-27244269 CCTTCTGGGGAGGTGATTGTTGG - Intronic
1022339489 7:29455059-29455081 CCTTCAGGGCAGGGGTAGGCAGG + Intronic
1022342969 7:29486111-29486133 CCCTCTGGTAAGGGGAAGGCAGG - Intronic
1023685029 7:42724870-42724892 CCTGCTTGGGAGGGCAAGGTAGG - Intergenic
1023759148 7:43447608-43447630 ACTGCTGAGGCGGGGAAGGATGG - Intronic
1023795582 7:43789432-43789454 TCTTATGGGGAGGAGAAGGCTGG - Intronic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1023888395 7:44376327-44376349 CCTGTTGGGGAGGGGAAGATGGG + Intergenic
1024358955 7:48447635-48447657 TTTTCTGAGGAGGGGAAGAATGG + Intronic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1025126051 7:56346008-56346030 CCTACTGGGGAGGCTGAGGAAGG + Intergenic
1025270530 7:57508713-57508735 GCTTCTGGGGAGGGAAGCGAGGG - Intergenic
1025836623 7:65100322-65100344 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1025906398 7:65789759-65789781 TTTTTTGGGGAGGTGAAGGAAGG - Intergenic
1025988956 7:66480286-66480308 TTTTTTGGGGAGGTGAAGGAAGG + Intergenic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026458056 7:70589957-70589979 CCTCCTGGGGAGGGGAAGAAAGG - Intronic
1026665615 7:72337509-72337531 CCTCTTTGGGAAGGGAAGGAAGG - Intronic
1026773747 7:73218350-73218372 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1026828218 7:73596786-73596808 CCTGCTGGGGTGGAGAAGGGCGG + Exonic
1026930368 7:74220195-74220217 CCTGCAGGGAGGGGGAAGGAGGG - Exonic
1027014606 7:74771744-74771766 CCTACTGGGGAGGCCAAGGCAGG + Intergenic
1027073427 7:75174213-75174235 CCTACTGGGGAGGCCAAGGCAGG - Intergenic
1027235279 7:76294337-76294359 CCTGGAGGGGAGGGGAAGAATGG + Intergenic
1027372812 7:77524373-77524395 ATTTCTGGGGAGAGAAAGGAAGG + Intergenic
1027672514 7:81119093-81119115 CCTTGTGGAGAGGGGAAGCAGGG + Intergenic
1029042029 7:97586301-97586323 CCTGTTGGGTAGGGGAAGGGAGG + Intergenic
1029605919 7:101599373-101599395 CCTTTTGGGGAATGGATGGAAGG - Intergenic
1030520901 7:110596655-110596677 ACTTCTGGGGAGCAGAAGAAGGG + Intergenic
1030540806 7:110828329-110828351 ACTACTGTGCAGGGGAAGGAGGG - Intronic
1031291772 7:119947164-119947186 CCTTCTGGGAAGGGAATGGGAGG - Intergenic
1031493667 7:122420901-122420923 CCTACTGGGGAAGGGGAGGGAGG + Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1031651413 7:124295129-124295151 GCTTGAGGGAAGGGGAAGGAAGG + Intergenic
1031718762 7:125141706-125141728 ATTTGTGGGGAAGGGAAGGAGGG + Intergenic
1032019660 7:128400307-128400329 CCTGCAGGGCAGGGGAAGCAGGG - Intronic
1032063429 7:128744831-128744853 TATTCAGGAGAGGGGAAGGAAGG + Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032389132 7:131544447-131544469 GCTTCTGGGGAAGGGCAGGGTGG - Intronic
1032460308 7:132105360-132105382 GCCTCTGGGGAAGGGAAGTAAGG + Intergenic
1032576312 7:133058999-133059021 GCTTCTGGGTAGGGGTTGGAAGG - Intronic
1032745578 7:134783131-134783153 CCTTGTAGGAAGGGCAAGGAAGG + Intronic
1033288495 7:140062221-140062243 CCGTGTGGGGTGGGGAGGGAGGG - Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034191490 7:149216682-149216704 TCTTCTGGAAAGGGGATGGAGGG + Intronic
1034349651 7:150407645-150407667 CCTGCGGGGGACGGGGAGGAGGG + Intronic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1035255712 7:157625570-157625592 ACTTGAGGGGAGGAGAAGGAGGG + Intronic
1035464411 7:159065277-159065299 ACTGCAGGGGAGGGGAGGGAGGG - Intronic
1036398469 8:8387474-8387496 CTTCCTGGGGAGGGGATAGAGGG - Intergenic
1036517227 8:9455513-9455535 ACTACTGGGGAGAGGGAGGAGGG + Intergenic
1036658936 8:10695434-10695456 CCTCCAGGGGGAGGGAAGGAGGG - Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037639360 8:20728801-20728823 GCCTCTGGGTAGAGGAAGGATGG - Intergenic
1038834097 8:31099290-31099312 GCTACTGGGGAGGGTAAGGCAGG + Intronic
1038969420 8:32615832-32615854 TCTTCTGAGGAAAGGAAGGAAGG + Intronic
1039268094 8:35850218-35850240 CATTATGGGGATGGGAGGGAGGG - Intergenic
1040050589 8:43009818-43009840 GCGGCTGGGGAGAGGAAGGAAGG - Intronic
1040455507 8:47593858-47593880 CCTTCTGCTGAGGGGTAGGAGGG + Intronic
1040563944 8:48549373-48549395 CTCTTTTGGGAGGGGAAGGAGGG + Intergenic
1040567778 8:48582607-48582629 CGCTCCGGGGAGGGGAGGGAGGG + Intergenic
1041324789 8:56652710-56652732 CATGCTGGGGAAGGCAAGGAAGG + Intergenic
1041417455 8:57627171-57627193 CCCTCTGGGGATGGGGAGCAGGG + Intergenic
1041572198 8:59350243-59350265 ACTTCTAGAGAGGGGAAGGAGGG + Intergenic
1041693831 8:60714947-60714969 CATAGTGGGGAGGGGCAGGAGGG + Intronic
1041771016 8:61472327-61472349 GTTTCTGGAGAGGGGAGGGAAGG + Intronic
1042144927 8:65718154-65718176 CACTCGGGGGAGGGGAAGGTTGG - Exonic
1045468698 8:102491844-102491866 CTTTCTGGGGAGGGCAGGCATGG + Intergenic
1045551997 8:103181137-103181159 ACCTCTGGGGAGTGGCAGGAAGG - Intronic
1046926102 8:119790906-119790928 CCTTCTTGGGAGGTGGAGGCAGG - Intronic
1047293742 8:123552795-123552817 TCTTCTGGGGGAGTGAAGGAAGG + Intergenic
1047376090 8:124298420-124298442 TCTTAAGGGCAGGGGAAGGAGGG - Intergenic
1047507285 8:125489776-125489798 CATTCTGAGGAGGAAAAGGAAGG - Intergenic
1047598039 8:126398202-126398224 ACACCTGGGGAGGGAAAGGAGGG - Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1048293696 8:133199083-133199105 CATGCTGGGGAGGAAAAGGAGGG + Intronic
1048319561 8:133387813-133387835 CCCTCTGGGGTGGGGGAGGAGGG + Intergenic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048823202 8:138398426-138398448 CCTGCAGGGGTGGGAAAGGAAGG - Intronic
1049144169 8:140985572-140985594 CCAAGTGGAGAGGGGAAGGATGG - Intronic
1049258138 8:141624757-141624779 TCTTCTGGGGAGGGTGAGGAGGG + Intergenic
1049405444 8:142450092-142450114 GCTGCTGGGGAAGGTAAGGAAGG + Exonic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049509751 8:143021610-143021632 CCTTCTGGGATGGGGCAGGCCGG - Exonic
1049522548 8:143101510-143101532 CCTTGTGGGGTAGGGAGGGAAGG + Intergenic
1049735386 8:144202349-144202371 CCCTCTGTGGAGGGGAAAGGAGG + Intronic
1049735413 8:144202446-144202468 CCCTCTGTGGAGGGGAAGAGAGG + Intronic
1050986537 9:12090780-12090802 CCATTTGGGGAGGGGAAGACAGG - Intergenic
1051263057 9:15284724-15284746 TCTTCTGAGGAGAGGAAGGGAGG + Intronic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051760431 9:20457627-20457649 CCTTTTGGGTGGGTGAAGGAGGG - Intronic
1051949023 9:22608204-22608226 CCTGCTGGGGGTGGGAAGAAAGG - Intergenic
1052024072 9:23555816-23555838 CCTCCTGGGAAGGGGAGAGAAGG + Intergenic
1052978229 9:34427858-34427880 CCTTCAGGTGAGTTGAAGGAGGG - Intronic
1053381779 9:37654981-37655003 CCTCCGGGGGCAGGGAAGGAGGG - Intronic
1053469714 9:38337713-38337735 CGTGCTGGGGACGGGGAGGAGGG - Intergenic
1053810765 9:41849420-41849442 GATTTTGGGGAGGGGAAGGGAGG + Intergenic
1054451178 9:65404279-65404301 CCTCCTGGGGTGGGGTGGGAGGG - Intergenic
1054619828 9:67338019-67338041 GATTTTGGGGAGGGGAAGGGAGG - Intergenic
1055447544 9:76397688-76397710 CCTTCTTGGGAGGCCGAGGAAGG - Intergenic
1055451602 9:76436061-76436083 CCTACTGGGGAGGCTGAGGAGGG - Intronic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1056785925 9:89592473-89592495 CCTGCTGGAGTGTGGAAGGAGGG + Intergenic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1057694451 9:97313417-97313439 TCTGCTGGAGAGGGGGAGGAAGG - Intronic
1057896782 9:98915591-98915613 CCTTGTGGTGAGTGGAAGGACGG - Intergenic
1058089691 9:100790894-100790916 TCTTCTGGGGATGGAATGGAGGG - Intergenic
1059506344 9:114803099-114803121 CTTTCTGGAGGAGGGAAGGAAGG - Intronic
1060000992 9:119958521-119958543 CCTGGAGGGGAGGGGAATGAGGG - Intergenic
1060162096 9:121373240-121373262 CCTTCTGGAGAAGATAAGGAGGG + Intergenic
1060163232 9:121386436-121386458 CAAGATGGGGAGGGGAAGGAGGG + Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1060823667 9:126675299-126675321 GCCTCTGGGGAGGGGACCGATGG + Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061202864 9:129147507-129147529 ACTGCTGGGGTGGGGAAGGCAGG - Exonic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061270879 9:129541363-129541385 CTTTCTGTTGATGGGAAGGAGGG - Intergenic
1061280824 9:129597035-129597057 CCTGCGGGGGATGGGAGGGAAGG - Intergenic
1061806586 9:133140584-133140606 CCTTCTGGGAAGGATAAGGGGGG - Intronic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1062015869 9:134291173-134291195 CCTTCTGGGGCTGAGAGGGAAGG - Intergenic
1062188388 9:135230725-135230747 CTTTGTGGGGTGGGGTAGGAGGG - Intergenic
1062221682 9:135419425-135419447 CCTGCTGGGGAAGGGAGGGATGG - Intergenic
1062245480 9:135563844-135563866 GATTCTGGGGAGGGCAAGCAGGG - Intronic
1062268527 9:135698509-135698531 CCTTCTCGGGGAGGGCAGGAGGG - Intronic
1062307006 9:135913291-135913313 CCTTCTGGGGAGGAGTTGGATGG + Intergenic
1062314170 9:135957612-135957634 TCTTCTGGGGAGGAGCAGGATGG - Intronic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1203435879 Un_GL000195v1:136751-136773 CCTTCTGGGGAGACTAAGGCAGG + Intergenic
1203470557 Un_GL000220v1:113914-113936 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203478378 Un_GL000220v1:157886-157908 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1186876109 X:13819885-13819907 CCTGCTGGGTAGGGTAGGGAAGG + Intronic
1186878257 X:13838684-13838706 CCCTTTGGGCAGGGGAAGGCAGG - Intronic
1186902416 X:14071080-14071102 CCTTCTGGGGAGTGGAATTAAGG + Intergenic
1187272766 X:17793649-17793671 CCTTCAGTGGAAGGGAAGGATGG + Intergenic
1187503134 X:19856649-19856671 GCCTCTGGGGAGGGGAAGTTGGG - Intronic
1187726085 X:22203439-22203461 CTTTCTGGAAAGGGGAAGGTTGG + Intronic
1188574580 X:31631524-31631546 CCTCCTGGGGAAGGCTAGGAAGG + Intronic
1188767765 X:34117601-34117623 ACTTCTGGCAAGGGGAGGGACGG - Intergenic
1189251008 X:39600719-39600741 CGGCCTGGGCAGGGGAAGGAGGG + Intergenic
1190266199 X:48828566-48828588 CCTTCTGGGGGTGGGAATGTTGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191215707 X:57930632-57930654 TTTTCTGGGGAGTGGAGGGAAGG + Intergenic
1192185463 X:68944019-68944041 CCTTCTGGGGAGGCTTCGGAAGG - Intergenic
1194245491 X:91506535-91506557 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1195065953 X:101238476-101238498 CCTTTGTGGGAGGGGAGGGAGGG + Intronic
1195910789 X:109886795-109886817 CCTTCTGGGAAGGAGAAACAGGG + Intergenic
1195996532 X:110737265-110737287 CCTTCTTGAGAGGAGAAGGAGGG + Intronic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1197862392 X:130984672-130984694 CCTGCAGGGGAAGGGAAGGCTGG + Intergenic
1198057376 X:133008351-133008373 CCTTCTGTGGAGGCGGAGGCAGG - Intergenic
1198148459 X:133882910-133882932 CCATCTGGGGAAGGGAAAGTGGG - Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198942399 X:141971002-141971024 CCTTCTAGGGATGGGATAGATGG - Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1199747658 X:150784107-150784129 CCTTCTGGGGATAGGGAGAAAGG + Intronic
1200099900 X:153685186-153685208 GCTGCTGGGGAGGGGCAGGGTGG - Intronic
1200228858 X:154434114-154434136 TCCTGTTGGGAGGGGAAGGAGGG + Intronic
1200564461 Y:4747787-4747809 ACTTCTAGAGAGGGGAGGGAGGG + Intergenic
1200804825 Y:7422494-7422516 CCTTCTGGGGAAGGGAGAGGGGG - Intergenic
1201896123 Y:18994363-18994385 CCCACAGGGGAGGGGAAGCAAGG - Intergenic