ID: 1032080734

View in Genome Browser
Species Human (GRCh38)
Location 7:128857249-128857271
Sequence AGGTAGTTGCCAGGGGCCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 2, 1: 0, 2: 5, 3: 31, 4: 406}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080734_1032080739 -5 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080739 7:128857267-128857289 TACCTCATTGCCATCAAGTACGG 0: 2
1: 0
2: 1
3: 8
4: 82
1032080734_1032080743 15 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080743 7:128857287-128857309 CGGTGGCCCCCAGCACATCGTGG 0: 2
1: 0
2: 0
3: 12
4: 83
1032080734_1032080749 30 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080734_1032080744 16 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080734_1032080741 -2 Left 1032080734 7:128857249-128857271 CCCATGGCCCCTGGCAACTACCT 0: 2
1: 0
2: 5
3: 31
4: 406
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080734 Original CRISPR AGGTAGTTGCCAGGGGCCAT GGG (reversed) Exonic