ID: 1032080736

View in Genome Browser
Species Human (GRCh38)
Location 7:128857256-128857278
Sequence GGCAATGAGGTAGTTGCCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032080736_1032080749 23 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG 0: 2
1: 1
2: 1
3: 14
4: 107
1032080736_1032080744 9 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080744 7:128857288-128857310 GGTGGCCCCCAGCACATCGTGGG 0: 2
1: 0
2: 1
3: 6
4: 92
1032080736_1032080750 29 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080750 7:128857308-128857330 GGGCAGCCCCTTCAAGGCCAAGG 0: 2
1: 1
2: 6
3: 31
4: 283
1032080736_1032080741 -9 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080741 7:128857270-128857292 CTCATTGCCATCAAGTACGGTGG 0: 2
1: 0
2: 2
3: 3
4: 37
1032080736_1032080743 8 Left 1032080736 7:128857256-128857278 CCCCTGGCAACTACCTCATTGCC 0: 2
1: 0
2: 0
3: 9
4: 189
Right 1032080743 7:128857287-128857309 CGGTGGCCCCCAGCACATCGTGG 0: 2
1: 0
2: 0
3: 12
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032080736 Original CRISPR GGCAATGAGGTAGTTGCCAG GGG (reversed) Exonic